Hướng dẫn quy trình kỹ thuật Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử – theo Bộ Y tế, Quyết định số 3336/QĐ-BYT ngày 20/07/2017

35
Quyết định số 3336/QĐ-BYT ngày 20/07/2017 của Bộ Y tế về việc ban hành tài liệu Hướng dẫn quy trình kỹ thuật Huyết học - Truyền máu - Miễn dịch - Di truyền - Sinh học phân tử
Quyết định số 3336/QĐ-BYT ngày 20/07/2017 của Bộ Y tế về việc ban hành tài liệu Hướng dẫn quy trình kỹ thuật Huyết học - Truyền máu - Miễn dịch - Di truyền - Sinh học phân tử
Đánh giá

TẢI PDF QUYẾT ĐỊNH TẠI ĐÂY

BỘ Y TẾ
——-
CỘNG HÒA XÃ HỘI CHỦ NGHĨA VIỆT NAM
Độc lập – Tự do – Hạnh phúc
—————
Số: 3336/QĐ-BYT Hà Nội, ngày 20 tháng 07 năm 2017

 

QUYẾT ĐỊNH

VỀ VIỆC BAN HÀNH TÀI LIỆU HƯỚNG DẪN QUY TRÌNH KỸ THUẬT HUYẾT HỌC – TRUYỀN MÁU – MIỄN DỊCH – DI TRUYỀN – SINH HỌC PHÂN TỬ

BỘ TRƯỞNG BỘ Y TẾ

Căn cứ Luật khám bệnh, chữa bệnh năm 2009;

Căn cứ Nghị định 75/2017/NĐ-CP ngày 20 tháng 6 năm 2017 của Chính phủ quy định chức năng, nhiệm vụ, quyền hạn và cơ cấu tổ chức của Bộ Y tế;

Xét Biên bản họp ngày 21 tháng 12 năm 2016 của Hội đồng nghiệm thu Quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học- Truyền máu- Miễn dịch- Di truyền- Sinh học phân tử của Bộ Y tế;

Theo đề nghị của Cục trưởng Cục Quản lý Khám, chữa bệnh,

QUYẾT ĐỊNH:

Điều 1. Ban hành kèm theo Quyết định này tài liệu “Hướng dẫn quy trình kỹ thuật chuyên ngành Huyết học- Truyền máu- Miễn dịch- Di truyền- Sinh học phân tử”, gồm 64 quy trình kỹ thuật.

Điều 2. Tài liệu “Hướng dẫn quy trình kỹ thuật chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phần tử” ban hành kèm theo Quyết định này được áp dụng tại các cơ sở khám bệnh, chữa bệnh.

Căn cứ vào tài liệu hướng dẫn này và điều kiện cụ thể của đơn vị, Giám đốc cơ sở khám bệnh, chữa bệnh xây dựng và ban hành tài liệu Hướng dẫn quy trình kỹ thuật thuật chuyên ngành Huyết học- Truyền máu- Miễn dịch- Di truyền- Sinh học phân tử phù hợp để thực hiện tại đơn vị.

Điều 3. Quyết định này có hiệu lực kể từ ngày ký ban hành.

Điều 4. Các ông, bà: Chánh Văn phòng Bộ, Cục trưởng Cục Quản lý Khám, chữa bệnh, Chánh Thanh tra Bộ, Cục trưởng và Vụ trưởng các Cục, Vụ thuộc Bộ Y tế, Giám đốc các bệnh viện, viện có giường bệnh trực thuộc Bộ Y tế, Giám đốc Sở Y tế các tỉnh, thành phố trực thuộc trung ương, Thủ trưởng Y tế các Bộ, Ngành và Thủ trưởng các đơn vị có liên quan chịu trách nhiệm thi hành Quyết định này./.

Nơi nhận:
– Như Điều 4;
– Bộ trưởng (để b/c);
– Các Thứ trưởng BYT;
– Bảo hiểm Xã hội Việt Nam (để phối hợp);
– Cổng thông tin điện tử BYT;
– Website Cục KCB;
– Lưu VT, KCB.

KT. BỘ TRƯỞNG
THỨ TRƯỞNG

Nguyễn Viết Tiến

 

BỘ Y TẾ
——-
CỘNG HÒA XÃ HỘI CHỦ NGHĨA VIỆT NAM
Độc lập – Tự do – Hạnh phúc
—————

 

DANH SÁCH 64 HƯỚNG DẪN QUY TRÌNH KỸ THUẬT HUYẾT HỌC- TRUYỀN MÁU-MIỄN DỊCH-DI TRUYỀN-SINH HỌC PHÂN TỬ

(Ban hành kèm theo Quyết định số 3336/QĐ-BYT ngày 20 tháng 07 năm 2017 của Bộ trưởng Bộ Y tế)

TT

TÊN QUY TRÌNH KỸ THUẬT

CHƯƠNG I. HUYẾT HỌC TẾ BÀO

1.

Tổng phân tích tế bào máu ngoi vi bằng máy đếm laser

2.

Tng phân tích tế bào máu ngoại vi bng hệ thống tự động hoàn toàn có nhuộm tiêu bản tự động

3.

Huyết đồ bng hệ thống t đng hoàn toàn

4.

Huyết đồ bằng máy đếm laser

5.

Thủ thuật chọc hút dịch tủy xương làm tủy đồ sử dụng mákhoan cầm tay

6.

Thủ thuật sinh thiết tủy xương sử dụng máy khoan cầm tay

7.

Thủ thuật sinh thiết tủy xương sử dụng kim sinh thiết dùng một lần

8.

Xét nghiệm mô bệnh học tủy xương

9.

Xét nghiệm sức bền hồng cầu (Of test)

10.

Xét nghiệm sàng lọc huyết sắc tố E (DCIP-Dichlorophenol Indophenol)

11.

Xét nghiệm nhuộm photphatase kiềm bạch cầu

12.

Xét nghiệm và chn đoán hóa mô miễn dịch tủy xương cho một dấu ấn (Marker) trên máy nhuộm tự đng
CHƯƠNG II. ĐÔNG CẦM MÁU

13.

Đo độ đàn hồi cục máu (ROTEM)

14.

Phát hiện chức chế phụ thuộc thời gian và nhiệt độ đường đông máu ni sinh

15.

Phát hiện chất ức chế không phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh

16.

Đinh lượng kháng thể kháng Beta2 Glycoprotein I (aβ2GPI) IgG-IgM bng kỹ thuật hóa miễn dịch phát quang

17.

Đnh lượng kháng thể kháng Cardiolipin IgG-IgM bằng kỹ thuật hóa miễn dch phát quang

18.

Định lượng kháng nguyên yếu tố XIII
CHƯƠNG III. MIỄN DỊCH – DI TRUYỀN – SINH HỌC PHÂN TỬ

19.

ANA 17 profile test (sàng lọc và định danh đng thời 17 typ kháng thể kháng nhân bng sắc ký min dch)

20.

Định lượng IL 2R (hay CD 25 hòa tan) trong huyết thanh bng kỹ thuật miễn dịch gn men (ELISA)

21.

Xét nghiệm kháng thể kháng tiểu cầu trực tiếp và gián tiếp bằng kỹ thuật FloCytometry

22.

Phân tích dấu ấn/CD/marker miễn dịch máu ngoại vi, hoặc dịch khác bằng kỹ thuật flow cytometry (làm cho 1 dấu ấn/CD/ marker)

23.

Phân tích dấu ấn/CD/marker min dịch tủy xương bng kỹ thuật flow cytometry (làm cho 1 dấu ấn/CD/ marker)

24.

Xét nghiệm kháng thể kháng Dengue IgG và IgM (phương pháp thm miễn dch)

25.

Xét nghiệm xác định đột biến Thalassemia (Phát hiện đồng thời 21 đột biến α-thalassemia hoặc 22 đột biến (β-thalasemia)

26.

Xác định gen bệnh máu bằng kỹ thuật cIg FISH

27.

Xét nghiệm giải trình tự gen trên hệ thống Miseq

28.

Xét nghiệm gen bng kỹ thuật FISH với tiêu bn Parafin

29.

Xét nghiệm virus Zika bằng kỹ thuật PCR
CHƯƠNG IV. HUYẾT THANH HỌC NHÓM MÁU

30.

Xác định kháng nguyên Mia của hệ nhóm máu MNS (Kỹ thuật ống nghim);

31.

Xác định kháng nguyên Micủa h nhóm máu MNS (Kỹ thuật Scangel/Gelcard);

32.

Xác định kháng nguyên H của hệ nhóm máu H (Kỹ thuật ống nghim);

33.

Xác định kháng nguyên H của hệ nhóm máu H (Kỹ thuật Scangel/Gelcard);

34.

Xác đnh nhóm máu Acủa hệ nhóm máu ABO (Kỹ thuật ống nghim);

35.

Xác định nhóm máu Acủa hệ nhóm máu ABO (Kỹ thuật Scangel/Gelcard);

36.

Xét nghiệm lựa chọn đơn vị máu phù hợp (10 đơn vị máu trong 3 điều kiện 22°C, 37°C, kháng globulin người) bằng kỹ thuật ống nghiệm);

37.

Xét nghiệm lựa chọn đơn vị máu phù hợp (10 đơn vị máu trong 3 điều kiện 22°C, 37oC, kháng globulin người) bằng kỹ thuật Scangel/Gelcard;

38.

Phản ứng hòa hợp có sử dụng kháng globulin người (Kỹ thuật ống nghim);

39.

Phản ứng hòa hợp có sử dụng kháng globulin người (Kỹ thuật Scangel/Gelcard trên máy bán tự động);

40.

Xác định kháng nguyên D yếu của hệ Rh (Kỹ thuật Scangel/Gelcard)

41.

Phản ứng hòa hợp tiểu cầu (Kỹ thuật pha rắn)

42.

Xác định kháng nguyên nhóm máu (Kỹ thuật sinh hphân tử)
CHƯƠNG V. CÔNG NGHỆ TẾ BÀO GỐC

43.

Xử lý tế bào gốc bằng máy tự động

44.

Xử lý tế bào gốc bằng phương pháp th công

45.

Đông lạnh khối tế bào gốc bằng hệ thống hạ nhiệt độ

46.

Rửa sản phẩm tế bào gốc sau bảo quản bng máy tự đng

47.

Rửa sản phẩm tế bào gốc sau bảo quản bằng phương pháp thủ công

48.

Đánh giá tỷ lệ sng của tế bào bng kỹ thuật nhuộm tế bào dòng chảy

49.

Định danh kháng thể Anti-HLA bng kỹ thuật ELISA

50.

Định danh kháng thể Anti-HLA bằng kỹ thuật luminex
CHƯƠNG VI. SINH HÓA HUYẾT HỌC

51.

Định lượng free kappa Huyết thanh

52.

Định lượng free Lambda Huyết thanh

53.

Định lượng Transferin Recepter hòa tan

54.

Độ bão hòa Transferin

55.

Định lượng sắt chưa bão hòa huyết thanh

56.

Đo khả năng gắn sắt toàn thể

57.

Định lượng vitamin B12 hot tính

58.

Định lượng Thymidine Kinase (TK)

59.

Định lượng IgA Kappa

60.

Định lượng IgA Lambda

61.

Định lượng IgG Kappa

62.

Định lượng IgG Lambda

63.

Định lượng IgM Kappa

64.

Định lượng IgM Lambda

 

KT. BỘ TRƯỞNG
THỨ TRƯỞNG

Nguyễn Viết Tiến

 

CHƯƠNG I. HUYẾT HỌC TẾ BÀO

TỔNG PHÂN TÍCH TẾ BÀO MÁU NGOẠI VI BẰNG MÁY LASER

(Complete blood count by laser hematology analyzers)

I. NGUYÊN LÝ

Các chỉ số tế bào máu phản ánh trực tiếp hoặc gián tiếp tình trạng sinh lý hoặc một số bệnh lý của cơ thể, có khả năng cung cấp những bằng chứng sớm nhất về các thay đổi tình trạng sức khỏe và tiến triển bệnh lý.

II. CHỈ ĐỊNH: xét nghiệm cơ bản

III. CHỐNG CHỈ ĐỊNH: Không có

IV. CHUẨN BỊ

1. Người thực hiện

01 kỹ thuật viên (làm bằng máy).

2. Phương tiện, hóa chất

2.1 Dụng cụ

– Máy đếm tế bào tự động theo nguyên lý trở kháng và laser;

– Máy in kèm theo;

– Máy lắc ống máu;

– Bàn sấy (đèn hoặc máy sấy tiêu bản);

– Cóng (bể) nhuộm tiêu bản;

– Giá cắm tiêu bản;

– Kính hiển vi quang học;

– Máy lập công thức bạch cầu;

Mã vạch, giấy in kết quả, sổ nhật ký máy, số lưu kết quả;

– Ống nghiệm có chất chống đông;

– Lam kính, lam kéo;

– Bút chì đánh dấu, bút dạ ghi số, bút bi vào sổ;

– Dầu soi kính, gạc;

Găng tay.

2.2 Hóa chất

– Máu chuẩn máy;

– Dung dịch chạy máy, rửa máy;

– Cồn tuyệt đối cố định tiêu bản;

– Dung dịch Giemsa nguyên chất và Giêm sa pha loãng 1/5;

3. Mẫu bệnh phẩm:

2ml máu ngoại vi chống đông bằng EDTA.

4. Phiếu xét nghiệm

Giấy chỉ định xét nghiệm (biểu mẫu số 30/BV 01), có ghi đầy đủ thông tin về người bệnh, có đánh dấu những thông số cần xét nghiệm, ghi rõ ngày tháng năm và chữ ký bác sĩ ra y lệnh.

V. CÁC BƯỚC TIẾN HÀNH

1. Nhận bệnh phẩm

– Kiểm tra mẫu máu: đủ số lượng và chất lượng, trên ống phải ghi đầy đủ thông tin phù hợp với giấy xét nghiệm;

– Điều dưỡng ghi và ký nhận vào sổ nhận bệnh phẩm;

– Dán mã vạch vào giấy xét nghiệm và ống máu (cùng một mã số);

– Nhập thông tin người bệnh vào phần mềm Medisoft và Labcom.

2. Tiến hành kỹ thuật

– Kiểm tra hóa chất và đồ tiêu hao: hóa chất còn hay hết, hạn sử dụng;

– Bật máy tính và bật máy xét nghiệm;

– Chuẩn máy (QC): để mẫu chuẩn lên máy lắc khoảng 10 phút. Khi máy đủ nhiệt độ thì tiến hành chuẩn tất cả các chỉ số theo từng lô. Sau khi đạt chuẩn thì tiến hành chạy mẫu.

– Kiểm tra mẫu trước khi chạy: thông tin hành chính, chất lượng mẫu.

– Chọn chế độ và chương trình làm việc tương ứng với chỉ định.

– Xếp mẫu bệnh phẩm lên rack bệnh phẩm, theo thứ tự từ trái sang phải, mặt mã vạch hướng về phía khe đọc. Đặt rack vào khay chuyển mẫu tự động.

– Chạy máy: khởi động chế độ chạy tự động, vừa chạy máy vừa theo dõi máy.

– Xem và in kết quả.

– Trường hợp có bất thường: kéo tiêu bản và nhuộm Giemsa. Sau đó, đọc trên kính hiển vi và đối chiếu tiêu bản với kết quả chạy máy.

VI. NHẬN ĐỊNH KẾT QUẢ

– Nếu kết quả chạy máy phù hợp với tiêu bản, nhân viên xét nghiệm ký, ghi ngày tháng xét nghiệm và trả.

– Nếu kết quả chạy máy không phù hợp, phải kiểm tra lại và báo cáo bác sĩ.

Lưu ý: Thời gian từ khi lấy máu ra khỏi thành mạch đến khi làm xét nghiệm không quá 6 giờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

– Nhầm mẫu bệnh phẩm.

– Máy chạy không đúng hoặc nhầm kết quả.

– Mẫu bệnh phẩm lấy không đủ số lượng, bị đông, hoặc vỡ hồng cầu.

2. Xử trí

– Báo lại lâm sàng trường hợp nhầm bệnh phẩm và giấy xét nghiệm.

– Chạy lại mẫu trường hợp nhầm kết quả.

– Yêu cầu lấy lại mẫu trong trường hợp mẫu không đạt chất lượng.

TỔNG PHÂN TÍCH TẾ BÀO MÁU NGOAI VI BẰNG HỆ THỐNG TỰ ĐỘNG HOÀN TOÀN (Có nhuộm tiêu bản tự động)

(Complete blood count by automated hematology analyzers – with automated slide staining)

I. ĐẠI CƯƠNG

Các chỉ số tế bào máu phản ánh trực tiếp hoặc gián tiếp tình trạng sinh lý hoặc một số bệnh lý của cơ thể, có khả năng cung cấp những bằng chứng sớm nhất về các thay đổi tình trạng sức khỏe và tiến triển bệnh lý.

II. CHỈ ĐỊNH: Xét nghiệm cơ bản

III. CHỐNG CHỈ ĐỊNH: Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện: 01 kỹ thuật viên (làm bằng máy).

2. Phương tiện, hoá chất

2.1 Dụng cụ

  • Máy đếm tế bào tự động kèm máy in;
  • Máy kéo nhuộm tiêu bản tự động;
  • Máy lắc ống máu;
  • Máy tính và máy in;
  • Lam kính;
  • Kính hiển vi quang học;
  • Máy lập công thức bạch cầu;
  • Gạc.
  • Mã vạch, giấy in kết quả, sổ nhật ký máy, số lưu kết quả;
  • Giá đựng tiêu bản;
  • Bút chì đánh dấu, bút dạ ghi số, bút bi vào sổ.

2.2. Hoá chất

  • Mẫu chuẩn;
  • Hoá chất chạy máy; rửa máy;
  • Hoá chất nhuộm lam;
  • Dầu soi, cồn tuyệt đối.

3. Mẫu bệnh phẩm: 2ml máu ngoại vi chống đông bằng EDTA.

4. Phiếu xét nghiệm : Giấy chỉ định xét nghiệm (biểu mẫu số 30/BV 01), có ghi đầy đủ thông tin về người bệnh, có đánh dấu những thông số cần xét nghiệm, ghi rõ ngày tháng năm và chữ ký bác sĩ ra y lệnh.

V. CÁC BƯỚC TIẾN HÀNH

1. Nhận bệnh phẩm

  • Kiểm tra mẫu máu: đủ số lượng và chất lượng, trên ống phải ghi đầy đủ thông tin phù hợp với giấy xét nghiệm.
  • Điều dưỡng ghi và ký nhận vào sổ nhận bệnh phẩm.
  • Dán mã vạch lên giấy xét nghiệm và ống máu (cùng một mã số).
  • Nhập thông tin người bệnh vào phần mềm Medisoft và Labconn.

2. Tiến hành kỹ thuật

  • Kiểm tra hóa chất và đồ tiêu hao: hóa chất còn hay hết, hạn sử dụng. Kiểm tra lam kính và đặt lam kính vào máy kéo lam tự động.
  • Bật máy tính và bật máy xét nghiệm (máy đếm tế bào tự động kết nối với máy kéo lam tự động).
  • Chuẩn máy (QC): để mẫu chuẩn lên máy lắc khoảng 10 phút. Khi máy đủ nhiệt độ thì tiến hành chuẩn tất cả các chỉ số theo từng lô. Sau khi đạt chuẩn thì tiến hành chạy mẫu.
  • Kiểm tra mẫu trước khi chạy: thông tin hành chính, chất lượng mẫu.
  • Chọn chế độ và chương trình làm việc tương ứng với chỉ định.
  • Xếp mẫu bệnh phẩm lên rack bệnh phẩm, theo thứ tự từ trái sang phải, mặt mã vạch hướng về phía khe đọc. Đặt rack vào khay chuyển mẫu tự động.
  • Chạy máy: khởi động chế độ chạy tự động, vừa chạy máy vừa theo dõi máy.
  • Trường hợp mẫu có bất thường, mẫu được chuyển sang máy kéo và nhuộm tiêu bản tự động.
  • Đọc trên kính hiển vi và đối chiếu tiêu bản với kết quả chạy máy.

VI. NHẬN ĐỊNH KẾT QUẢ

  • Nếu kết quả chạy máy phù hợp với tiêu bản, nhân viên xét nghiệm ký, ghi ngày tháng xét nghiệm và trả.
  • Nếu kết quả chạy máy không phù hợp với tiêu bản, phải kiểm tra lại hoặc báo cáo bác sĩ hoặc người phụ trách.

Lưu ý: Thời gian từ khi lấy máu ra khỏi thành mạch đến khi làm xét nghiệm không quá 6 giờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

  • Nhầm mẫu bệnh phẩm.
  • Máy chạy không đúng hoặc nhầm kết quả.
  • Mẫu bệnh phẩm lấy không đủ số lượng, bị đông, hoặc vỡ hồng cầu.

2. Xử trí

  • Báo lại lâm sàng trường hợp nhầm bệnh phẩm và giấy xét nghiệm.
  • Chạy lại mẫu trường hợp nhầm kết quả.
  • Yêu cầu lấy lại mẫu trong trường hợp mẫu không đạt chất lượng.

HUYẾT ĐỒ (Bằng hệ thống tự động hoàn toàn)

(Hemogram by automated hematology analyzers)

I. ĐẠI CƯƠNG

Số lượng, hình thái, thành phần tế bào máu ngoại vi có thể phản ánh nhiều tình trạng sinh lý cũng như bệnh lý của cơ thể. Huyết đồ là bản tổng kết có bình luận các biểu hiện đó. Qua đó, có thể đưa ra một số định hướng cho bác sỹ điều trị.

II. CHỈ ĐỊNH

– Khi có biểu hiện bất thường trên xét nghiệm tổng phân tích tế bào máu:

+ Tăng hoặc giảm số lượng bạch cầu, bất thường về công thức bạch cầu.

+ Thiếu máu hoặc tăng số lượng hồng cầu, lượng huyết sắc tố.

+ Tăng hoặc giảm số lượng tiểu cầu.

– Có các cảnh báo bất thường sau khi chạy máy đếm tế bào.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ dịnh.

IV. CHUẨN BỊ

1. Người thực hiện

– 01 kỹ thuật viên làm xét nghiệm (làm bằng máy);

– 01 cử nhân chuyên khoa huyết học đọc kết quả.

2. Phương tiện, hóa chất

2.1. Dụng cụ

– Máy đếm tế bào tự động;

– Máy kéo nhuộm tiêu bản tự động;

– Máy lắc ống máu;

– Máy tính và máy in;

– Lam kính;

– Kính hiển vi quang học;

– Máy lập công thức bạch cầu;

– Gạc lau kính;

– Mã vạch, giấy in kết quả, sổ nhật ký máy, số lưu kết quả;

– Giá để ống nghiệm, giá cắm tiêu bản;

– Bút chì đánh dấu, bút dạ ghi số, bút bi vào sổ.

2.2. Hóa chất

– Mẫu chuẩn;

– Hoá chất chạy máy; rửa máy;

– Hoá chất nhuộm lam;

– Dầu soi, cồn tuyệt đối.

3. Mẫu bệnh phẩm: 2ml máu ngoại vi chống đông bằng EDTA.

4. Phiếu xét nghiệm

Giấy chỉ định xét nghiệm (biểu mẫu số 30/BV 01), có ghi đầy đủ thông tin về người bệnh, có đánh dấu những thông số cần xét nghiệm, ghi rõ ngày tháng năm và chữ ký bác sĩ ra y lệnh.

V. CÁC BƯỚC TIẾN HÀNH

1. Nhận bệnh phẩm

– Kiểm tra mẫu máu: đủ số lượng và chất lượng, trên ống phải ghi đầy đủ thông tin phù hợp với giấy xét nghiệm.

– Điều dưỡng ghi và ký nhận vào sổ nhận bệnh phẩm.

– Dán mã vạch lên giấy xét nghiệm và ống máu (cùng một mã số).

– Nhập thông tin người bênh vào phần mềm Medisoft và Labconn.

2. Tiến hành kỹ thuật

– Kiểm tra hóa chất và đồ tiêu hao: hóa chất còn hay hết, hạn sử dụng. Kiểm tra lam kính và đặt lam kính vào máy kéo lam tự động;

– Bật máy tính và bật máy xét nghiệm (máy tổng phân tích tế bào máu và máy kéo lam tự động);

– Chuẩn máy (QC): để mẫu chuẩn lên máy lắc khoảng 10 phút. Khi máy đủ nhiệt độ thì tiến hành chuẩn tất cả các chỉ số theo từng lô. Sau khi đạt chuẩn thì tiến hành chạy mẫu;

– Kiểm tra mẫu trước khi chạy: thông tin hành chính, chất lượng mẫu;

– Chọn chế độ và chương trình làm việc tương ứng với chỉ định;

– Xếp mẫu bệnh phẩm lên rack bệnh phẩm, theo thứ tự từ trái sang phải, mặt mã vạch hướng về phía khe đọc. Đặt rack vào khay chuyển mẫu tự động;

– Chạy máy: khởi động chế độ chạy tự động, vừa chạy máy vừa theo dõi máy;

– In kết quả chạy máy;

– Mẫu được chuyển sang máy kéo và nhuộm tiêu bản tự động;

– Đọc và nhận định kết quả trên kính hiển vi quang học.

VI. NHẬN ĐỊNH KẾT QUẢ

– Quan sát tiêu bản, đối chiếu với các chỉ số trên máy đếm tế bào và phân tích:

+ Hồng cầu: số lượng hồng cầu, lượng huyết sắc tố; đặc điểm về phân bố, kích thước tế bào, bình sắc hay nhược sắc, bất thường về hình thái hoặc các thể trong hồng cầu (nếu có), có hồng cầu non và tỷ lệ hồng cầu lưới.

+ Bạch cầu: số lượng và công thức bạch cầu, bất thường về hình thái nếu có.

+ Tiểu cầu: số lượng và độ tập trung tiểu cầu, bất thường về hình thái (nếu có).

+ Bất thường khác: ký sinh trùng sốt rét..

– Tổng hợp các thông tin và có thể đưa ra một số định hướng về bệnh như: thiếu máu thiếu sắt, Thalassemia, lơ-xê-mi cấp, lơ-xê-mi kinh…; Gợi ý các xét nghiệm nên làm.

Lưu ý: Thời gian từ khi lấy máu ra khỏi thành mạch đến khi làm xét nghiệm không quá 6 giờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

  • Nhầm mẫu bệnh phẩm.
  • Máy chạy không đúng hoặc nhầm kết quả.
  • Mẫu bệnh phẩm lấy không đủ số lượng, bị đông, hoặc vỡ hồng cầu.

2. Xử trí

  • Báo lại lâm sàng trường hợp nhầm bệnh phẩm và giấy xét nghiệm.
  • Chạy lại mẫu trường hợp nhầm kết quả.
  • Yêu cầu lấy lại mẫu trong trường hợp mẫu không đạt chất lượng.

HUYẾT ĐỒ (Bằng máy laser)

(Hemogram by laser hematology analyzers)

I. ĐẠI CƯƠNG

Số lượng, hình thái, thành phần tế bào máu ngoại vi có thể phản ánh nhiều tình trạng sinh lý cũng như bệnh lý của cơ thể. Huyết đồ là bản tổng kết có bình luận các biểu hiện đó. Qua đó, có thể đưa ra một số định hướng cho bác sỹ điều trị.

II. CHỈ ĐỊNH

– Khi có biểu hiện bất thường trên xét nghiệm tổng phân tích tế bào máu:

+ Tăng hoặc giảm số lượng bạch cầu, bất thường về công thức bạch cầu.

+ Thiếu máu hoặc tăng số lượng hồng cầu, lượng huyết sắc tố.

+ Tăng hoặc giảm số lượng tiểu cầu.

– Có các cảnh báo bất thường sau khi chạy máy đếm tế bào.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1.Người thực hiện

  • 01 kỹ thuật viên (làm bằng máy).
  • 01 cử nhân chuyên khoa huyết học đọc kết quả.

2. Phương tiện, hóa chất

2.1. Dụng cụ

Máy đếm tế bào tự động theo nguyên lý trở kháng và laser;

Máy lắc ống máu;

Máy tính và máy in;

Bàn sấy tiêu bản;

Lam kính; Lam kéo;

Cóng, bể nhuộm tiêu bản;

Kính hiển vi quang học;

Máy lập công thức bạch cầu;

Gạc;

Mã vạch, giấy in kết quả, sổ nhật ký máy, số lưu kết quả;

Giá để ống nghiệm, giá đựng tiêu bản;

Bút chì đánh dấu, bút dạ ghi số, bút bi vào sổ.

2.2. Hóa chất

Mẫu chuẩn;

Hoá chất chạy máy; rửa máy;

Hoá chất nhuộm Giêmsa (nguyên chất và pha loãng 1/5);

Dầu soi;

Cồn tuyệt đối.

3. Mẫu bệnh phẩm: 2ml máu ngoại vi chống đông bằng EDTA.

4. Phiếu xét nghiệm

Giấy chỉ định xét nghiệm (biểu mẫu số 30/BV 01), có ghi đầy đủ thông tin về người bệnh, có đánh dấu những thông số cần xét nghiệm, ghi rõ ngày tháng năm và chữ ký bác sĩ ra y lệnh.

V. CÁC BƯỚC TIẾN HÀNH

1. Nhận bệnh phẩm

  • Kiểm tra mẫu máu: đủ số lượng và chất lượng, trên ống phải ghi đầy đủ thông tin phù hợp với giấy xét nghiệm.
  • Điều dưỡng ghi và ký nhận vào sổ nhận bệnh phẩm
  • Dán mã vạch lên giấy xét nghiệm và ống máu (cùng một mã số).
  • Nhập thông tin người bệnh vào phần mềm Medisoft và Labconn.

2. Tiến hành kỹ thuật

  • Kiểm tra hóa chất và đồ tiêu hao: hóa chất còn hay hết, hạn sử dụng. Kiểm tra lam kính và đặt lam kính vào máy kéo lam tự động.
  • Bật máy tính và bật máy xét nghiệm.
  • Chuẩn máy (QC): để mẫu chuẩn lên máy lắc khoảng 10 phút. Khi máy đủ nhiệt độ thì tiến hành chuẩn tất cả các chỉ số theo từng lô. Sau khi đạt chuẩn thì tiến hành chạy mẫu.
  • Kiểm tra mẫu trước khi chạy: thông tin hành chính, chất lượng mẫu.
  • Chọn chế độ và chương trình làm việc tương ứng với chỉ định.
  • Xếp mẫu bệnh phẩm lên rack bệnh phẩm, theo thứ tự từ trái sang phải, mặt mã vạch hướng về phía khe đọc.
  • Đặt rack vào khay chuyển mẫu tự động.
  • Chạy máy: khởi động chế độ chạy tự động, chạy máy và theo dõi máy.
  • In kết quả chạy máy.
  • Làm tiêu bản máu đàn và nhuộm Giemsa
  • Đọc và nhận định kết quả trên kính hiển vi quang học

VI. NHẬN ĐỊNH KẾT QUẢ

– Quan sát tiêu bản, đối chiếu với các chỉ số trên máy đếm tế bào và phân tích:

+ Hồng cầu: số lượng hồng cầu, lượng huyết sắc tố; Đặc điểm về phân bố, kích thước tế bào, bình sắc hay nhược sắc, bất thường về hình thái hoặc các thể trong hồng cầu (nếu có), có hồng cầu non và tỷ lệ hồng cầu lưới.

+ Bạch cầu: số lượng và công thức bạch cầu, bất thường về hình thái nếu có.

+ Tiểu cầu: số lượng và độ tập trung tiểu cầu, bất thường về hình thái nếu có.

+ Bất thường khác: ký sinh trùng sốt rét..

– Tổng hợp các thông tin và có thể đưa ra một số định hướng về bệnh như: thiếu máu thiếu sắt, Thalassemia, lơ-xê-mi cấp, lơ-xê-mi kinh…; Gợi ý các xét nghiệm nên làm.

Lưu ý: Thời gian từ khi lấy máu ra khỏi thành mạch đến khi làm xét nghiệm không quá 6 giờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

  • Nhầm mẫu bệnh phẩm.
  • Máy chạy không đúng hoặc nhầm kết quả.
  • Mẫu bệnh phẩm lấy không đủ số lượng, bị đông, hoặc vỡ hồng cầu.

2. Xử trí

  • Báo lại lâm sàng trường hợp nhầm bệnh phẩm và giấy xét nghiệm.
  • Chạy lại mẫu trường hợp nhầm kết quả.
  • Yêu cầu lấy lại mẫu trong trường hợp mẫu không đạt chất lượng.

THỦ THUẬT CHỌC HÚT DỊCH TỦY XƯƠNG LÀM XÉT NGHIỆM TỦY ĐỒ BẰNG MÁY KHOAN CẦM TAY

(Procedure of bone marrow aspirate for bone marrow aspiration by machine)

I. ĐẠI CƯƠNG

Tuỷ đồ là xét nghiệm phân tích số lượng và hình thái các tế bào tuỷ xương để thăm dò chức năng tạo máu cũng như gợi ý các nguyên nhân gây rối loạn chức năng tạo máu tại tuỷ xương.

II. CHỈ ĐỊNH

  • Chẩn đoán xác định, theo dõi điều trị các bệnh lý cơ quan tạo máu như lơ-xê-mi, rối loạn sinh tủy
  • Đánh giá tình trạng sinh máu của tủy trong các bệnh lý khác: nhiễm trùng, bệnh hệ thống, ung thư di căn

III. CHỐNG CHỈ ĐỊNH

Chống chỉ định tương đối khi làm thủ thuật:

  • Người bệnh có rối loạn đông máu hoặc dùng các thuốc tăng nguy cơ chảy máu.
  • Không làm thủ thuật tại vị trí đang có nhiễm trùng.

IV. CHUẨN BỊ

1. Người thực hiện

  • 01 bác sĩ chuyên khoa huyết học.
  • 02 kỹ thuật viên chuyên khoa hỗ trợ thủ thuật.
  • 01 kỹ thuật viên giúp việc.

2. Phương tiện – hóa chất

  • Phòng thủ thuật vô khuẩn;
  • Dụng cụ đã tiệt trùng (khay quả đậu, xe tiêm, hộp dụng cụ);
  • Săng vô khuẩn;
  • Găng tay vô khuẩn;
  • Xốp cầm máu, bông, gạc, urgo;
  • Bơm tiêm 5ml, 10 ml, 3 ml;
  • Kim lấy thuốc;
  • Bộ sinh thiết tủy xương bằng máy khoan cầm tay;
  • Tay khoan;
  • Bàn sấy (hoặc đèn hoặc máy sấy tiêu bản);
  • Giá cắm tiêu bản;
  • Ống nghiệm có chất chống đông EDTA;
  • Lam kính, lam kéo;
  • Bút chì đánh dấu tiêu bản, bút dạ ghi số ống, bút bi vào sổ;
  • Mũ, khẩu trang, quần áo bảo hộ lao động.

2.2 Hóa chất

  • Dung dịch cố định Helly.
  • Thuốc gây tê Lindocain 2%
  • Vật liệu sát trùng: cồn iốt 5%, cồn 70oC.

3. Người bệnh

  • Phải được bác sĩ tư vấn, giải thích trước khi làm xét nghiệm để người bệnh yên tâm và cùng cộng tác.
  • Thử test thuốc gây tê có kết quả âm tính.

4. Phiếu xét nghiệm

  • Có giấy chỉ định xét nghiệm huyết tủy đồ ghi đầy đủ thông tin về người bệnh.
  • Có kết quả thử test thuốc gây tê âm tính với chữ ký của người đọc kết quả.

 V. CÁC BƯỚC TIẾN HÀNH

1. Kiểm tra hồ sơ

2. Kiểm tra người bệnh

  • Kiểm tra đối chiếu các thông tin giữa người bệnh và chỉ định xét nghiệm
  • Người bệnh được giải thích lý do, tư vấn tâm lý trước khi làm thủ thuật
  • Tư thế người bệnh: nằm sấp với vị trí chọc là gai chậu sau trên.

3. Tiến hành kỹ thuật

– Lấy máu tĩnh mạch (quy trình lấy máu tĩnh mạch) cho vào ống chống đông EDTA và kéo 4-6 tiêu bản máu đàn.

– Xác định vị trí chọc tủy ở gai chậu sau trên.

– Sát trùng da theo hình xoáy ốc từ điểm mốc ra xung quanh bán kính 5 cm bằng cồn iod, sau đó bằng cồn 70o.

– Trải săng vô khuẩn.

– Gây tê từng lớp, đặc biệt là màng xương.

– Chờ 2 phút.

– Chọc kim qua da và cơ

+ Nghiêng 45° so với mặt da, ấn nhẹ kim qua da.

+ Dựng kim thẳng đứng, đưa kim khoan nhẹ nhàng qua lớp cơ.

– Khoan kim vào khoang tủy

+ Xác định lại điểm mốc.

+ Lắp đốc kim vào đầu nối máy khoan.

+ Dựng thẳng kim, khoan kim qua màng xương đến ổ tủy (thường sâu 0,5-1 cm).

– Lấy dịch tủy xương.

+ Tháo kim khỏi máy khoan.

+ Dùng bơm tiêm 10 ml hút lấy 0,5ml dịch tủy, cho vào ống chống đông 0,3ml dịch, còn lại gạn lấy cặn kéo 8-10 tiêu bản, có thể làm lam áp nếu cần.

– Rút kim ra nhanh sau khi hút đủ dịch tủy xương.

– Băng cầm máu bằng xốp cầm máu và băng Urgo.

– Dặn dò người bệnh cách chăm sóc và theo dõi vết chọc.

VI. NHẬN ĐỊNH KẾT QUẢ

  • Dịch tủy không bị đông, có nhiều hạt tủy.
  • Tiêu bản dàn đều, đẹp.
  • Vị trí làm thủ thuật không chảy máu.

VII. THEO DÕI

Theo dõi trong vòng 15 phút không thấy máu thấm ra băng thì cho người bệnh ra khỏi phòng theo dõi.

VIII. XỬ TRÍ TAI BIẾN

Nói chung ít có tai biến. Có thể người bệnh lo lắng, sợ hãi: cần giải thích rõ để người bệnh yên tâm, trẻ em có thể dùng tiền mê, an thần nhẹ.

– Đau: gây tê tốt vị trí chọc.

– Sốc dị ứng thuốc gây tê: phải thử test trước.

– Nhiễm trùng nơi chọc: dụng cụ và thao tác phải đảm bảo vô trùng.

– Chảy máu vị trí chọc tủy:

+ Hạn chế sinh thiết tủy xương khi người bệnh có rối loạn đông cầm máu. Dừng thuốc có khả năng làm tăng nguy cơ chảy máu trước 1 tuần.

+ Băng ép cầm máu tại chỗ.

+ Dùng thuốc cầm máu (nếu cần).

THỦ THUẬT SINH THIẾT TỦY XƯƠNG (sử dụng máy khoan cầm tay)

(Procedure of bone marrow biopsy by machine)

I. NGUYÊN LÝ

Sinh thiết tủy xương là kỹ thuật khảo sát cấu trúc mô bệnh học của tủy tạo máu. Đây là thủ thuật khó tiến hành và nhận định kết quả, đòi hỏi chuẩn bị kỹ lưỡng và thực hiện bởi bác sĩ chuyên khoa huyết học có kinh nghiệm.

II. CHỈ ĐỊNH

– Chẩn đoán xác định, chẩn đoán giai đoạn, theo dõi điều trị các bệnh thuộc hội chứng tăng sinh tủy mạn tính, hội chứng tăng sinh lympho, rối loạn sinh tủy, suy tủy xương.

– Hỗ trợ chẩn đoán (lơ xê mi cấp, xuất huyết giảm tiểu cầu…) trong các trường hợp tủy đồ nghèo tế bào.

– Chẩn đoán các trường hợp ung thư di căn tủy xương, u lympho xâm lấn tủy xương.

III. CHỐNG CHỈ ĐỊNH

Chống chỉ định tương đối trong trường hợp

– Có rối loạn đông máu;

– Đang sử dụng thuốc làm tăng nguy cơ chảy máu như: aspirin, heparin;

– Người bệnh có các bệnh lý nội khoa nặng khác kèm theo như: suy hô hấp.

IV. CHUẨN BỊ

1. Người thực hiện

– 01 bác sĩ.

– 02 kỹ thuật viên phụ thủ thuật.

– 01 kỹ thuật viên giúp việc.

2. Phương tiện – hóa chất

2.1. Phương tiện

  • Phòng thủ thuật vô khuẩn;
  • Dụng cụ đã tiệt trùng (khay quả đậu, xe tiêm, hộp dụng cụ);
  • Săng vô khuẩn;
  • Găng tay vô khuẩn;
  • Xốp cầm máu, bông, gạc, urgo;
  • Bơm tiêm 5ml;
  • Kim lấy thuốc;
  • Bộ sinh thiết tủy xương bằng máy khoan cầm tay
  • Tay khoan;
  • Lọ thủy tinh 60ml (lọ cổ to);
  • Mũ, khẩu trang, bảo hộ lao động.

2.2. Hóa chất

  • Dung dịch cố định Helly;
  • Thuốc gây tê Lindocain 2%;
  • Vật liệu sát trùng: cồn iôd 5%, cồn 70oC.

3. Người bệnh

Người bệnh được giải thích về sự cần thiết, các tai biến có thể có của thủ thuật.

4. Phiếu xét nghiệm

– Có phiếu chỉ định xét nghiệm ghi đầy đủ thông tin của người bệnh.

– Có kết quả thử test thuốc gây tê âm tính với chữ ký của người đọc kết quả.

V. CÁC BƯỚC TIẾN HÀNH

1. Kiểm tra hồ sơ

2. Kiểm tra người bệnh

  • Kiểm tra đối chiếu các thông tin giữa người bệnh và chỉ định xét nghiệm
  • Người bệnh được giải thích lý do, tư vấn tâm lý trước khi làm thủ thuật
  • Tư thế: người bệnh nằm sấp, thoải mái

3. Tiến hành kỹ thuật

– Xác định vị trí chọc sinh thiết ở gai chậu sau trên.

– Sát trùng da theo hình xoáy ốc từ điểm mốc ra xung quanh bán kính 5 cm bằng cồn iod, sau đó bằng cồn 70o .

– Trải săng vô khuẩn

– Gây tê từng lớp, đặc biệt là màng xương.

– Chờ 2 phút.

– Chọc kim sinh thiết qua da và cơ:

+ Nghiêng 45o so với mặt da, ấn nhẹ kim qua da

+ Dựng kim thẳng đứng khoan nhẹ nhàng qua lớp cơ.

– Khoan kim vào khoang tủy

+ Xác định lại điểm mốc.

+ Lắp đốc kim vào đầu nối máy khoan.

+ Dựng thẳng kim, khoan nhẹ kim trên màng xương, cố định kim khoan.

– Lấy mảnh sinh thiết tủy xương

+ Tháo máy khoan ra khỏi đốc kim, rút nòng kim.

+ Lắp đốc kim vào đầu nối máy khoan, tiếp tục khoan 1,5 – 2cm, sau đó rút kim ra khỏi xương, màng xương và da. Lưu ý là phải bấm máy khoan liên tục từ lúc khoan vào tiếp cho tới khi rút kim ra khỏi da.

+ Tháo kim khỏi máy khoan

+ Dùng thông nòng để lấy mảnh sinh thiết.

– Cầm máu, dán băng.

– Thả mảnh sinh thiết vào dung dịch cố định.

– Tháo vỏ bọc khoan để giữ lại tay khoan.

4. Theo dõi

Theo dõi trong 15 phút, không thấy máu thấm ra băng thì cho người bệnh về.

VI. NHẬN ĐỊNH KẾT QUẢ

– Mảnh sinh thiết đẹp: dài 1,5 – 2cm, không bị nát, xoắn vặn

– Vị trí làm sinh thiết không chảy máu

VII. XỬ TRÍ TAI BIẾN

Nói chung ít có tai biến. Có thể người bệnh lo lắng, sợ hãi: cần giải thích rõ để người bệnh yên tâm, trẻ em có thể dùng tiền mê, an thần nhẹ.

– Đau: gây tê tốt vị trí chọc

– Sốc dị ứng thuốc gây tê: phải thử test trước.

– Chảy máu vị trí sinh thiết:

+ Hạn chế sinh thiết tủy xương khi người bệnh có rối loạn đông cầm máu. Dừng thuốc có khả năng làm tăng nguy cơ chảy máu trước 1 tuần.

+ Băng ép cầm máu tại chỗ.

+ Dùng thuốc cầm máu (nếu cần).

– Nhiễm trùng vị trí sinh thiết: dụng cụ và thao tác phải đảm bảo vô trùng.

Dùng thuốc kháng sinh phổ rộng 5-7 ngày.

THỦ THUẬT SINH THIẾT TỦY XƯƠNG (sử dụng kim sinh thiết dùng 01 lần)

(Procedure of bone marrow biopsy by needle biopsy using 1 times)

I. NGUYÊN LÝ

Sinh thiết tuỷ xương là kỹ thuật khảo sát cấu trúc mô bệnh học của tuỷ tạo máu. Bằng kỹ thuật cố định, cắt lát và nhuộm tổ chức học, xét nghiệm sinh thiết tủy xương cho phép khảo sát:

– Cấu trúc mô bệnh học của tủy sinh máu.

– Số lượng, hình thái, cấu trúc, thành phần và vị trí nguyên ủy cảu tế bào máu và các bất thường của hệ thống liên võng (xơ, sợi).

II. CHỈ ĐỊNH

– Chẩn đoán xác định, chẩn đoán giai đoạn, theo dõi điều trị các bệnh thuộc hội chứng tăng sinh tủy mạn tính, hội chứng tăng sinh lympho, rối loạn sinh tủy, suy tủy xương.

– Hỗ trợ chẩn đoán (lơ xê mi cấp, xuất huyết giảm tiểu cầu…) trong các trường hợp tủy đồ nghèo tế bào.

– Chẩn đoán các trường hợp ung thư di căn tủy xương, u lympho xâm lấn tủy xương.

III. CHỐNG CHỈ ĐỊNH

– Có rối loạn đông máu.

– Đang sử dụng thuốc làm tăng nguy cơ chảy máu như: Aspirin, heparin…

– Người bệnh có các bệnh lý nội khoa nặng khác kèm theo như: Suy tim, suy hô hấp, hôn mê.

IV. CHUẨN BỊ

1. Người thực hiện

– 01 bác sĩ.

– 02 kỹ thuật viên phụ thủ thuật.

– 01 kỹ thuật viên giúp việc.

2. Phương tiện – hóa chất

2.1. Phương tiện

  • Phòng thủ thuật vô khuẩn;
  • Dụng cụ đã tiệt trùng (khay quả đậu, xe tiêm, hộp dụng cụ);
  • Săng vô khuẩn;
  • Găng tay vô khuẩn;
  • Xốp cầm máu, bông, gạc, urgo;
  • Bơm tiêm 5ml;
  • Kim lấy thuốc;
  • Bộ kim sinh thiết tủy xương một lần;
  • Lọ thủy tinh 60ml (lọ cổ to);
  • Mũ, khẩu trang, bảo hộ lao động.

2.2. Hóa chất

  • Dung dịch cố định Helly;
  • Thuốc gây tê Lindocain 2%;
  • Vật liệu sát trùng: cồn iôd 5%, cồn 70oC.

3. Người bệnh

Người bệnh được giải thích về sự cần thiết, các tai biến có thể có của thủ thuật.

4. Phiếu xét nghiệm

  • Có phiếu chỉ định xét nghiệm ghi đầy đủ thông tin của người bệnh.
  • Có kết quả thử test thuốc gây tê âm tính với chữ ký của người đọc kết quả.

V. CÁC BƯỚC TIẾN HÀNH

1. Kiểm tra hồ sơ

2. Kiểm tra người bệnh

  • Kiểm tra đối chiếu các thông tin giữa người bệnh và chỉ định xét nghiệm
  • Người bệnh được giải thích lý do, tư vấn tâm lý trước khi làm thủ thuật
  • Tư thế: người bệnh nằm sấp, thoải mái

3. Tiến hành kỹ thuật

– Xác định vị trí chọc sinh thiết ở gai chậu sau trên.

– Sát trùng da theo hình xoáy ốc từ điểm mốc ra xung quanh bán kính 5 cm bằng cồn iod, sau đó bằng cồn 70o.

– Trải săng vô khuẩn.

– Gây tê từng lớp, đặc biệt là màng xương.

– Chờ 2 phút.

– Chọc kim sinh thiết qua da và cơ:

+ Nghiêng 45o so với mặt da, ấn nhẹ kim qua da.

+ Dựng kim thẳng đứng khoan nhẹ nhàng qua lớp cơ.

– Khoan kim vào khoang tủy

+ Xác định lại điểm mốc.

+ Dựng thẳng kim, khoan nhẹ kim trên màng xương, cố định kim khoan.

– Lấy mảnh sinh thiết tủy xương.

+ Rút nòng kim.

+ Lắp nắp nhựa lên đốc kim, tiếp tục khoan nhẹ nhàng 1-1,5 cm…

+ Lắc nhẹ kim để cắt rời mảnh sinh thiết khỏi tổ chức xương xung quanh.

+ Xoay kim tại chỗ theo một chiều 2-3 vòng.

+ Từ từ rút kim, khi thân kim qua khỏi màng xương, nghiêng kim, nhẹ nhàng rút kim khỏi mặt da.

+ Dùng thông nòng để lấy mảnh sinh thiết.

– Cầm máu, dán băng.

– Thả mảnh sinh thiết vào dung dịch cố định.

3. Theo dõi

Theo dõi trong 15 phút, không thấy máu thấm ra băng thì cho người bệnh về.

VI. NHẬN ĐỊNH KẾT QUẢ

  • Mảnh sinh thiết đẹp: dài 1,5 – 2cm, không bị nát, xoắn vặn
  • Vị trí làm sinh thiết không chảy máu

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

Nói chung ít có tai biến. Có thể người bệnh lo lắng, sợ hãi: cần giải thích rõ để người bệnh yên tâm, trẻ em có thể dùng tiền mê, an thần nhẹ.

– Đau: gây tê tốt vị trí chọc.

– Sốc dị ứng thuốc gây tê: phải thử test trước.

– Chảy máu vị trí sinh thiết:

+ Hạn chế sinh thiết tủy xương khi người bệnh có rối loạn đông cầm máu.

Dừng thuốc có khả năng làm tăng nguy cơ chảy máu trước 1 tuần.

+ Băng ép cầm máu tại chỗ.

+ Dùng thuốc cầm máu (nếu cần).

– Nhiễm trùng vị trí sinh thiết: dụng cụ và thao tác phải đảm bảo vô trùng. Dùng thuốc kháng sinh phổ rộng 5-7 ngày.

THỦ THUẬT SINH THIẾT TỦY XƯƠNG (sử dụng kim sinh thiết dùng 01 lần)

(Procedure of bone marrow biopsy by needle biopsy using 1 times)

I. NGUYÊN LÝ

Sinh thiết tuỷ xương là kỹ thuật khảo sát cấu trúc mô bệnh học của tuỷ tạo máu. Bằng kỹ thuật cố định, cắt lát và nhuộm tổ chức học, xét nghiệm sinh thiết tủy xương cho phép khảo sát:

– Cấu trúc mô bệnh học của tủy sinh máu.

– Số lượng, hình thái, cấu trúc, thành phần và vị trí nguyên ủy cảu tế bào máu và các bất thường của hệ thống liên võng (xơ, sợi).

II. CHỈ ĐỊNH

– Chẩn đoán xác định, chẩn đoán giai đoạn, theo dõi điều trị các bệnh thuộc hội chứng tăng sinh tủy mạn tính, hội chứng tăng sinh lympho, rối loạn sinh tủy, suy tủy xương.

– Hỗ trợ chẩn đoán (lơ xê mi cấp, xuất huyết giảm tiểu cầu…) trong các trường hợp tủy đồ nghèo tế bào.

– Chẩn đoán các trường hợp ung thư di căn tủy xương, u lympho xâm lấn tủy xương.

III. CHỐNG CHỈ ĐỊNH

  • Có rối loạn đông máu.
  • Đang sử dụng thuốc làm tăng nguy cơ chảy máu như: Aspirin, heparin…
  • Người bệnh có các bệnh lý nội khoa nặng khác kèm theo như: Suy tim, suy hô hấp, hôn mê.

IV. CHUẨN BỊ

1. Người thực hiện

01 bác sĩ.

02 kỹ thuật viên phụ thủ thuật.

01 kỹ thuật viên giúp việc.

2. Phương tiện – hóa chất

2.1. Phương tiện

  • Phòng thủ thuật vô khuẩn;
  • Dụng cụ đã tiệt trùng (khay quả đậu, xe tiêm, hộp dụng cụ);
  • Săng vô khuẩn;
  • Găng tay vô khuẩn;
  • Xốp cầm máu, bông, gạc, urgo;
  • Bơm tiêm 5ml;
  • Kim lấy thuốc;
  • Bộ kim sinh thiết tủy xương một lần;
  • Lọ thủy tinh 60ml (lọ cổ to);
  • Mũ, khẩu trang, bảo hộ lao động.

2.2. Hóa chất

  • Dung dịch cố định Helly;
  • Thuốc gây tê Lindocain 2%;
  • Vật liệu sát trùng: cồn iôd 5%, cồn 70oC.

3. Người bệnh

Người bệnh được giải thích về sự cần thiết, các tai biến có thể có của thủ thuật.

4. Phiếu xét nghiệm

  • Có phiếu chỉ định xét nghiệm ghi đầy đủ thông tin của người bệnh.
  • Có kết quả thử test thuốc gây tê âm tính với chữ ký của người đọc kết quả.

V. CÁC BƯỚC TIẾN HÀNH

1. Kiểm tra hồ sơ

2. Kiểm tra người bệnh

  • Kiểm tra đối chiếu các thông tin giữa người bệnh và chỉ định xét nghiệm
  • Người bệnh được giải thích lý do, tư vấn tâm lý trước khi làm thủ thuật
  • Tư thế: người bệnh nằm sấp, thoải mái

3. Tiến hành kỹ thuật

– Xác định vị trí chọc sinh thiết ở gai chậu sau trên.

– Sát trùng da theo hình xoáy ốc từ điểm mốc ra xung quanh bán kính 5 cm bằng cồn iod, sau đó bằng cồn 70o.

– Trải săng vô khuẩn.

– Gây tê từng lớp, đặc biệt là màng xương.

– Chờ 2 phút.

– Chọc kim sinh thiết qua da và cơ:

+ Nghiêng 45o so với mặt da, ấn nhẹ kim qua da.

+ Dựng kim thẳng đứng khoan nhẹ nhàng qua lớp cơ.

– Khoan kim vào khoang tủy

+ Xác định lại điểm mốc.

+ Dựng thẳng kim, khoan nhẹ kim trên màng xương, cố định kim khoan.

– Lấy mảnh sinh thiết tủy xương.

+ Rút nòng kim.

+ Lắp nắp nhựa lên đốc kim, tiếp tục khoan nhẹ nhàng 1-1,5 cm…

+ Lắc nhẹ kim để cắt rời mảnh sinh thiết khỏi tổ chức xương xung quanh.

+ Xoay kim tại chỗ theo một chiều 2-3 vòng.

+ Từ từ rút kim, khi thân kim qua khỏi màng xương, nghiêng kim, nhẹ nhàng rút kim khỏi mặt da.

+ Dùng thông nòng để lấy mảnh sinh thiết.

– Cầm máu, dán băng.

– Thả mảnh sinh thiết vào dung dịch cố định.

3. Theo dõi

Theo dõi trong 15 phút, không thấy máu thấm ra băng thì cho người bệnh về.

VI. NHẬN ĐỊNH KẾT QUẢ

Mảnh sinh thiết đẹp: dài 1,5 – 2cm, không bị nát, xoắn vặn

Vị trí làm sinh thiết không chảy máu

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

Nói chung ít có tai biến. Có thể người bệnh lo lắng, sợ hãi: cần giải thích rõ để người bệnh yên tâm, trẻ em có thể dùng tiền mê, an thần nhẹ.

– Đau: gây tê tốt vị trí chọc.

– Sốc dị ứng thuốc gây tê: phải thử test trước.

– Chảy máu vị trí sinh thiết:

+ Hạn chế sinh thiết tủy xương khi người bệnh có rối loạn đông cầm máu. Dừng thuốc có khả năng làm tăng nguy cơ chảy máu trước 1 tuần.

+ Băng ép cầm máu tại chỗ.

+ Dùng thuốc cầm máu (nếu cần).

– Nhiễm trùng vị trí sinh thiết: dụng cụ và thao tác phải đảm bảo vô trùng. Dùng thuốc kháng sinh phổ rộng 5-7 ngày.

XÉT NGHIỆM MÔ BỆNH HỌC TỦY XƯƠNG

(Histopathology of bone marrow biopsy)

I. ĐẠI CƯƠNG

Xét nghiệm mô bệnh học tủy xương là quá trình xử lý, nhuộm (HE, PAS) và phân tích kết quả mảnh sinh thiết tủy xương. Nhằm đánh giá: Cấu trúc mô bệnh học của tuỷ sinh máu; Số lượng, hình thái, cấu trúc, thành phần và vị trí nguyên uỷ của các dòng tế bào. Từ đó giúp hỗ trợ chẩn đoán các bệnh lý liên quan đến cơ quan tạo máu.

II. CHỈ ĐỊNH

Các bệnh lý liên quan đến cơ quan tạo máu, cần khảo sát mô bệnh học tủy xương.

III. CHỐNG CHỈ ĐỊNH: không có

IV. CHUẨN BỊ

1. Người thực hiện

  • 01 bác sĩ phân tích kết quả.
  • 01 kỹ thuật viên xử lý và nhuộm HE, PAS mảnh sinh thiết tủy xương.

2. Phương tiện – Hóa chất

2.1. Dụng cụ

  • Máy chuyển mẫu tự động;
  • Máy đúc tự động;
  • Máy cắt tiêu bản;
  • Máy nhuộm tiêu bản tự động.
  • Bàn sấy 37oC;
  • Kính hiển vi quang học;
  • Giá gỗ cài tiêu bản: 02 chiếc;
  • Gạc thấm nước: 03 chiếc;
  • Bút chì hoặc bút viết kính: 01 chiếc;
  • Lamen 22 x 24 hoặc 22 x 22.

2.2. Hóa chất

– Dung dịch khử canxi:

+ Dung dịch I: axit formic, nước cất;

+ Dung dịch II: Tri- natricitrat, nước cất.

– Hóa chất chuyển đúc mảnh sinh thiết:

+ Cồn tuyệt đối 1, 2, 3;

+ Xylen 1, 2, 3;

+ Paraffin.

– Tẩy paraffin

+ Toluen 1,2,3;

+ Cồn tuyệt đối 1,2,3, cồn 80 độ.

– Hóa chất nhuộm HE

+ Dung dịch hemalun demayer;

+ Dung dịch erythrosin;

+ Dung dịch lugol;

+ Dung dịch Na2S2O3 5%;

+ Dung dịch Na2CO3 1%;

+ Acid HCL l%: để trong bể nhuộm 200ml.

– Hóa chất nhuộm PAS

+ Dung dịch Periodic;

+ Shiff;

+ CaCO3;

+ Hematoxylin.

– Boom Canada: lấy ra cốc nhỏ, để trong tủ 60oC.

3. Người bệnh/ Mẫu bệnh phẩm

  • Mảnh tổ chức tủy xương đã có thông tin (tên, tuổi…), ký hiệu.
  • Số lượng: 02 tiêu bản /1người bệnh.

4. Hồ sơ bệnh án/phiếu xét nghiệm

  • Giấy xét nghiệm chỉ định của bác sĩ điều trị
  • Quy trình kỹ thuật xét nghiệm

V. CÁC BƯỚC TIẾN HÀNH

1. Xử lý mảnh sinh thiết tủy xương

– Khử canxi

– Chuyển trong hóa chất trên máy chuyển tự động gồm các bước:

+ Rửa mẫu

+ Đẩy nước bằng ngâm mẫu trong cồn

+ Đẩy cồn bằng Xylen

– Đúc khuôn paraffin mảnh sinh thiết trên máy đúc tự động.

– Bảo quản khuôn mảnh sinh thiết trong ngăn tủ mát (2-8oC).

2. Chuẩn bị tiêu bản

– Cắt tiêu bản sinh thiết tủy xương chiều dày 2-2,5 Lim.

3. Các phương pháp nhuộm

  • Nhuộm HE tiêu bản sinh thiết tủy xương trên máy nhuộm tiêu bản tự động.
  • Nhuộm PAS tiêu bản sinh thiết tủy xương trên máy nhuộm tiêu bản tự động
  • Gắn lamen

VI. NHẬN ĐỊNH KẾT QUẢ

– Tiêu bản sinh thiết đẹp và tiêu chuẩn khi:

+ Dài 1-1,5cm, có ít nhất 10 khoang sinh máu, một lớp tế bào.

+ Giữ nguyên vẹn cấu trúc mô bệnh học tuỷ xương.

– Quan sát bằng vật kính x10 (đánh giá chung):

+ Kích thước mảnh sinh thiết

+ Có sai sót kỹ thuật như ép tuỷ quá mạnh, chạm mạch máu, hay xé rách khoang tạo máu hay không.

+ Có những thay đổi cấu trúc lớn như di căn ung thư, hoặc u lympho hay không?

– Quan sát bằng vật kính x40 (đánh giá chi tiết):

+ Đặc điểm cấu trúc và thành phần khoang tạo máu (kích thước bè xương và khoang sinh máu, mật độ và đặc điểm phân bố tế bào).

+ Có sai sót kỹ thuật như ép tủy quá mạnh, chạm mạch máu, hay xé rách khoang tạo máu hay không?

+ Đặc điểm về hình thái học và tương quan số lượng của các dòng tế bào: hồng cầu, bạch cầu, tiểu cầu.

+ Đánh giá tình trạng xơ, mỡ, dự trữ sắt, huỷ cốt bào và tạo cốt bào.

+ Tình trạng xâm nhập của các tế bào ngoài tuỷ, đặc biệt là di căn ung thư.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

– Xử lý mảnh sinh thiết không tốt.

– Cắt tiêu bản quá dày.

– Sai sót trong quá trình nhuộm:

+ Tiêu bản chưa khô hẳn trước khi nhuộm.

+ Thời gian nhuộm các thì hóa chất không phù hợp.

+ Hóa chất đã bị thay đổi nồng độ.

+ Kỹ năng chuyên môn của kỹ thuật viên chưa ổn định.

– Kỹ năng chuyên môn của người nhận định kết quả chưa tốt.

2. Xử trí

– Tuân thủ qui trình xử lý, cắt, nhuộm tiêu bản.

– Pha hóa chất đúng loại, nồng độ.

– Nâng cao tay nghề kỹ thuật viên.

– Nâng cao chuyên môn của người nhận định kết quả.

XÉT NGHIỆM SỨC BỀN HỒNG CẦU (OF TEST)

(Osmotic fragility test)

I. NGUYÊN LÝ

Kiểm tra sức bền hồng cầu ở nồng độ dung dịch Natri clorua 0,36%.

II. CHỈ ĐỊNH

Sàng lọc bệnh Thalassemia.

III. CHỐNG CHỈ ĐỊNH: Không có

IV. CHUẨN BỊ

1. Người thực hiện: Kỹ thuật viên xét nghiệm

2. Phương tiện, hóa chất

2.1. Dụng cụ

Micropipet 20-100pl + đầu côn phù hợp;

Giá cắm ống nghiệm máu;

Đồng hồ hẹn giờ Quater time (nếu có);

Khay để đầu côn bẩn.

2.2. Hóa chất

Bộ kít OF test.

3. Bệnh phẩm

– 2ml máu ngoại vi của người bệnh được chống đông bằng EDTA.

– 2ml máu ngoại vi của người bình thường (mẫu chứng).

4. Hồ sơ bệnh án/Phiếu xét nghiệm

– Phiếu xét nghiệm có thông tin phù hợp với ống máu.

– Quy trình kỹ thuật đã được phê duyệt.

V. CÁC BƯỚC TIẾN HÀNH

  • Ghi tên hoặc mã số của mẫu chứng và người bênh trên mỗi ống nghiệm;
  • Cho vào mỗi ống nghiệm 20 pl máu;
  • Lắc ống nghiệm 2-3 lần;
  • Để trong nhiệt độ phòng thí nghiệm 5 phút;
  • Nhận định kết quả.

VI. NHẬN ĐỊNH KẾT QUẢ

Nhận định kết quả phải được thực hiện ngay khi đủ thời gian. Đặt ống bệnh và ống chứng phía trước thước đo và quan sát 3 hàng kẻ trên thước đo:

– Âm tính: Ống nghiệm có màu đỏ rõ ràng, dòng kẻ rõ.

– Dương tính: Ống nghiệm có màu đỏ dục, dòng kẻ mờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

  • Đọc kết quả chậm, không đúng thời gian
  • Hút máu không đủ số lượng.
  • Không đảo đều mẫu máu trước khi hút.
  • Bộ kít: quá hạn sử dụng, điều kiện bảo quản không đúng, có bất thường của ống nghiệm trong bộ kít như màu sắc, độ trong…

2. Xử trí

  • Kiểm tra chất lượng, hạn sử dụng bộ kít trước khi tiến hành xét nghiệm.
  • Đảo đều mẫu máu và hút đủ số lượng.
  • Đọc kết quả ngay sau khi đủ thời gian.

XÉT NGHIỆM SÀNG LỌC HUYẾT SẮC TỐ E

DCIP – Dichlorophenol Indophenol
(Screening hemoglobin E test – DCIP)

I. NGUYÊN LÝ

DCIP (Dichlorophenol Indophenol) là một loại thuốc nhuộm tổng hợp có màu xanh. Huyết sắc tố E và các phân tử hemoglobin không ổn định khác sẽ bị kết tủa khi tiếp xúc với thuốc nhuộm này ở 37oC trong pH 7,5.

II. CHỈ ĐỊNH

  • Sàng lọc bệnh Thalassemia.
  • Sàng lọc bệnh huyết sắc tố E.

III. CHỐNG CHỈ ĐỊNH: Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện: Kỹ thuật viên xét nghiệm

2. Phương tiện, hóa chất

2.1. Dụng cụ

  • Micropipet 20-100pl + đầu côn phù hợp;
  • Giá cắm ống nghiệm máu;
  • Tủ ấm đặt nhiệt độ 37oC;
  • Đồng hồ hẹn giờ Quater time (nếu có);
  • Gạc sạch hoặc giấy thấm;
  • Hộp để đầu côn bẩn.

2.2. Hóa chất

  • Bộ kít DCIP test.
  • Vitamin C 1/10 (pha 1ml Vitamin C với 9ml nước cất).

3. Bệnh phẩm

  • 2ml máu ngoại vi của người bệnh được chống đông bằng EDTA.
  • 2ml máu ngoại vi của người bình thường (mẫu chứng).

4. Hồ sơ bệnh án/Phiếu xét nghiệm

  • Phiếu xét nghiệm có thông tin phù hợp với ống máu.
  • Quy trình đã được phê duyệt.

V. CÁC BƯỚC TIẾN HÀNH

  • Ghi tên hoặc mã số của mẫu chứng và người bệnh trên mỗi ống nghiệm.
  • Cho vào mỗi ống nghiệm 20 pl máu.
  • Lắc ống nghiệm 2-3 lần.
  • Ủ ống nghiệm trong panmari ở 37oC trong 30 phút.
  • Lấy mẫu khỏi panmari, cho thêm 20 pl vitamin C 1/10.
  • Lắc ống nghiệm 2-3 lần.
  • Đặt ống chứng và ống bệnh phẩm lên trên thước đo (theo bộ test) và đọc kết quả.

VI. NHẬN ĐỊNH KẾT QUẢ

Nhận định kết quả phải được thực hiện ngay sau khi cho thêm vitamin C. Đặt ống nghiệm và ống chứng phía trước thước đo và quan sát 3 hàng kẻ trên thước đo:

  • Âm tính: Ống nghiệm có màu nâu đỏ rõ ràng, dòng kẻ rõ.
  • Dương tính: Ống nghiệm có màu nâu đỏ đục, dòng kẻ mờ.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1.Sai sót

  • Đọc kết quả chậm, màu sắc mẫu xét nghiệm sẽ được thay đổi từ màu nâu đỏ sang màu đỏ, dễ gây âm tính giả.
  • Hút máu không đủ số lượng.
  • Không đảo đều mẫu máu trước khi hút.
  • Bộ kít xét nghiệm quá hạn sử dụng, bảo quản không đúng, có bất thường về màu sắc, độ trong…

2. Xử trí

  • Kiểm tra chất lượng, hạn sử dụng bộ kít trước khi tiến hành xét nghiệm.
  • Đảo đều mẫu máu và hút đủ số lượng.
  • Đọc kết quả ngay sau khi đủ thời gian.

XÉT NGHIỆM NHUỘM PHOTPHATASE KIỀM BẠCH CẦU

(Procedure of leukocyte alkaline phosphatase staining)

I. NGUYÊN LÝ

Muối phốt phát của X naphtol dưới tác động của men phosphatase kiềm bạch cầu trong môi trường có ion magie sẽ giải phóng ra X Naphtol. X Naphtol kết hợp với muối diazo (fast blue) tạo thành một sản phẩm azo tủa, có màu.

II. CHỈ ĐỊNH

  • Xếp loại bệnh Lơxêmi cấp;
  • Hỗ trợ chẩn đoán hình thái học trong chẩn đoán bệnh lý rối loạn sinh tủy hoặc các trường hợp khác.

III. CHỐNG CHỈ ĐỊNH: Không có

IV. CHUẨN BỊ

1.Người thực hiện: Kỹ thuật viên Huyết học.

2. Phương tiện, hóa chất

2.1. Dụng cụ

  • Bàn sấy hoặc quạt sấy tiêu bản;
  • Kính hiển vi quang học;
  • Bể nhuộm tiêu bản dung tích 100ml;
  • Tủ ấm hoặc bình cách thủy 37oc;
  • Giá gỗ cài tiêu bản;
  • Pipet Paster;
  • Ống đong 5ml;
  • Gạc thấm nước;
  • Bút chì.

2.2. Hóa chất

* Dung dịch cơ chất.

  • 40 mg Napthol AS – BI phosphat;
  • 1200 µL dimethyl formamide;
  • Muối Fast blue RR salr.

* Hóa chất cố định;

  • Formandehyt 40%;

* Pha dung dịch đệm Tris pH=8:

  • Tris: 2,43g;
  • Nước cất: 25ml;
  • Acid HCL 1N: 18,5ml;
  • Nước cất vừa đủ 100ml.

* Dung dịch nhuộm nền – dung dịch Kernetrot:

  • Nuclear fas red (C14H8NNaO7S): 200mg;
  • Al2NH4(SO4)3: 5g;
  • Nước cất (H2O): 100ml.

Cho 100ml nước cất vào cốc cho Al2NH4(SO4)3 vào đun sôi cho tan hết, cho tiếp nuclear fas red vào để sôi 1 phút bắc ra để nguội và cho thêm vài hạt thymol vào để bảo quản ở nhiệt độ phòng, khi dùng phải lọc ỗể trong tủ ấm.

* Hóa chất khác: Dầu soi kính hiển vi.

3. Người bệnh/ Mẫu bệnh phẩm

  • 01 Tiêu bản máu ngoại vi hoặc dịch tủy xương của người bệnh theo chỉ định: đã ghi thông tin (tên, tuổi…), ký hiệu PAL, đã khô.
  • 01 tiêu bản của mẫu máu ngoại vi có tỷ lệ bạch cầu đoạn trung tính > 70% (tiêu bản chứng).

4. Hồ sơ bệnh án/phiếu xét nghiệm

  • Giấy xét nghiệm chỉ định của Bác sĩ điều trị.
  • Quy trình kỹ thuật xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

  • Cố định bằn cồn focmol 10%: 15 phút.
  • Rửa dưới vòi nước chảy 30 giây, để khô.
  • Ủ trong dung dịch nhuộm 1 giờ, 37oC
  • Rửa dưới vòi nước chảy, để khô.
  • Nhuộm nền bằng dung dịch Kernetrot.

Chú ý: tiêu bản phải được cố định ngay, càng sớm càng tốt.

VI. NHẬN ĐỊNH KẾT QUẢ

Các tế bào dương tính có các hạt xám đen trong bào tương. Tính score trong 100 tế bào cần xem xét.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

1. Sai sót

  • Dung dịch nhuộm nền không đạt tiêu chuẩn (do để lâu ngày).
  • Cố định tiêu bản chưa tốt.
  • Tiêu bản chưa khô hẳn trước khi nhuộm các thì khác.
  • Thời gian ngâm tiêu bản trong dung dịch nhuộm quá dài hoặc quá ngắn.

2. Xử trí

– Kiểm tra hóa chất, pha hóa chất đúng loại, nồng độ tiêu chuẩn.

– Tuân thủ qui trình nhuộm: cố định tốt, để khô tiêu bản, thời gian phản ứng phù hợp.

XÉT NGHIỆM VÀ CHẨN ĐOÁN HÓA MÔ MIỄN DỊCH TỦY XƯƠNG CHO MỘT DẤU ẤN (MARKER) TRÊN MÁY NHUỘM TỰ ĐỘNG


(Test and diagnostic on immunohistochemical bone marrow biopsy for a marker by automated staining machines)

I. NGUYÊN LÝ

Nhuộm hóa mô miễn dịch mảnh sinh thiết tủy xương là phương pháp nhuộm sử dụng các kháng thể đã biết để xác định kháng nguyên có trong tổ chức tủy xương. Đây là kỹ thuật kết hợp phản ứng miễn dịch và hóa chất trên máy nhuộm chuyên dụng để làm hiện rõ các kháng nguyên hiện diện trong tế bào (bào tương, màng tế bào, nhân tế bào).

II. CHỈ ĐỊNH

  • Nghi ngờ u lympho xâm lấn tủy xương;
  • Nghi ngờ K di căn tủy xương;
  • Nghi ngờ tăng sinh bất thường các dòng tế bào trong tủy xương.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • Kỹ thuật viên chuyên khoa xét nghiệm thực hiện kỹ thuật máy;
  • Bác sĩ chuyên khoa Huyết học thực hiện phân tích kết quả.

2. Phương tiên hóa chất

2.1. Dụng cụ

  • Máy nhuộm hóa mô miễn dịch;
  • Máy cắt tiêu bản;
  • Bàn sấy;
  • Micropitpet + đầu côn;
  • Giá cài tiêu bản;
  • Lam kính chuyên dụng (theo máy);
  • Lamen gắn tiêu bản (theo máy);
  • Gạc sạch.

2.2. Hóa chất

  • Các hóa chất khử parafin;
  • Cồn;
  • Nước cất, nước rửa (Dewax);
  • Dung dịch Buffer (IHC);
  • Kháng thể 1 (Anti Human – Tùy từng CD theo chỉ định);
  • Kháng thể 2 (Envision + HRP – REF: K5007);
  • Bộ định màu DAB + Chomogen (REF: K5007);
  • Dung dịch Hematoxylin 5% 100ml;
  • Boom Canada: Lấy ra cốc nhỏ, để trong tủ 60oC.

2.3. Bệnh phẩm

Lốc nến mảnh sinh thiết tủy xương

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị tiêu bản

  • Đúc khuôn parafin mảnh sinh thiết tủy xương đã được xử lý, làm nguội và để trong tủ lạnh 2-8oC.
  • Cắt tiêu bản mỏng 0,2 LL111, dán trên lam kính chuyên dụng.
  • Sấy khô tiêu bản trong tủ ấm 37oC trong thời gian 12 giờ.

2. Tiến hành nhuộm

  • Khởi động máy nhuộm;
  • Xác lập quy trình chạy; Xác định quy trình cho từng lam kính;
  • Chọn hóa chất, kháng thể sử dụng theo chỉ định;
  • In nhãn dán lên lam kính; Đặt từng lam kính vào khay chứa lam; Nạp khay chứa lam vào máy.
  • Tiến hành nhuộm lam cho từng tiêu bản với loại kháng thể phù hợp theo chương trình đã cài đặt; Theo dõi tình trạng và tiến trình vận hành máy;
  • Kết thúc nhuộm: Tháo khay chứa lam kính, lấy lam kính và gắn lamen.

VI. NHẬN ĐỊNH KẾT QUẢ

Việc nhận định kết quả hình thái được khẳng định ở hai tiêu chí: âm tính và dương tính.

– Âm tính: Trên kính hiển vi quan sát thấy nhân của các tế bào bắt màu xanh tím của Hematoxylin, nguyên sinh chất không có biểu hiện gì.

– Dương tính: Nếu có sự hiện diện kháng nguyên trên tế bào, phức hợp kháng nguyên- kháng thể – DAB Chromogen sẽ cho màu vàng nâu trên nguyên sinh chất của tế bào, nhân của tế bào bắt màu xanh tím của Hematoxylin.

VII. NHỮNG SAI SÓT THƯỜNG GẶP

  • Xử lý mảnh sinh thiết không tốt;
  • Thời gian nhuộm các bước không phù hợp;
  • Kỹ năng của người thực hiện kỹ thuật chưa ổn định.

TÀI LIỆU THAM KHẢO

  1. Đỗ Trung Phấn (2013). Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng. Nhà xuất bản Y học.
  2. Hướng dẫn quy trình kĩ thuật Bệnh viện, Nhà xuất bản Y học, 2014.
  3. Hướng dẫn sử dụng máy nhuộm hóa mô miễn dịch.

CHƯƠNG II: ĐÔNG CẦM MÁU

ĐO ĐỘ ĐÀN HỒI CỤC MÁU

(RotationThromboElastoMetry: ROTEM)

I. NGUYÊN LÝ

Là xét nghiệm ghi lại sự thay đổi động học quá trình đông máu của máu tĩnh mạch đã được chống đông bằng citrat thông qua hệ thống cup (chứa mẫu máu với sự có mặt của các chất hoạt hóa hoặc ức chế) và pin (ghi nhận hiện tượng đông máu). Các biến đổi động học được ghi lại thông qua hệ thống quang học và kết quả được biểu diễn bằng đồ thị và các chỉ số.

II. CHỈ ĐỊNH

  • Chẩn đoán các trường hợp nghi ngờ có rối loạn cầm – đông máu.
  • Theo dõi điều trị rối loạn cầm – đông máu.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • 1 kỹ thuật viên xét nghiệm.
  • 1 bác sỹ duyệt kết quả.

2. Phương tiện, hóa chất

  • Máy xét nghiệm đông máu ROTEM;
  • Tủ lạnh;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm plastic có chống đông citrat natri 3,2% hoặc 3,8%;
  • Pipette tự động;
  • – Hóa chất: in-tem, r ex-tem, fib-tem, star-tem, hep-tem, ap-tem, natem, trap tem           (tùy loại xét nghiệm).

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, gường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

  • Bật máy ROTEM, chờ đủ nhiệt độ (khoảng 10′).
  • Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh.
  • Trộn máu và chất chống đông citrat natri 3,2% hoặc 3,8% (tỷ lệ 1 thể tích chống đông: 9 thể tích máu).
  • Đặt ống máu vào buồng ủ của máy 5 phút.
  • Đặt hóa chất đã chuẩn bị vào vị trí ở khay hóa chất của máy, chờ 5 phút.
  • Chọn kênh xét nghiệm và loại xét nghiệm trên máy ROTEM.
  • Tiến hành kỹ thuật theo các bước được hướng dẫn hiển thị trên màn hình của máy.

VI. NHẬN ĐỊNH KẾT QUẢ

  • In kết quả (biểu đồ và chỉ số) vào giấy xét nghiệm.
  • Ghi ngày, tháng, năm tiến hành xét nghiệm.
  • Bác sỹ duyệt và ký tên vào vị trí người duyệt kết quả xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

  • Mẫu máu bị đông, để >4h từ khi lấy máu đến khi làm xét nghiệm.
  • Thời gian ủ mẫu chưa đủ.
  • Lắp pin vào trục không chặt.
  • Hút sai loại hóa chất.

PHÁT HIỆN CHẤT ỨC CHẾ PHỤ THUỘC THỜI GIAN VÀ NHIỆT ĐỘ
ĐƯỜNG ĐÔNG MÁU NỘI SINH

(Intrinsic coagulation pathway inhibitor with time and temperature dependence)

I. NGUYÊN LÝ

Xét nghiệm APTT (Actived Partial Thromboplastin Time) giúp đánh giá các yếu tố tham gia đường đông máu nội sinh. Xét nghiệm APTT kéo dài có thể do 1 trong 2 nguyên nhân chính sau:

  • Do thiếu một hoặc nhiều yếu tố tham gia đường đông máu nội sinh.
  • Do có chất ức chế (phụ thuộc thời gian và nhiệt độ) một hoặc nhiều yếu tố tham gia đường đông máu nội sinh.

Tiến hành xét nghiệm APTT với mẫu huyết tương trộn theo tỷ lệ 1:1 giữa huyết tương người bệnh và huyết tương bình thường (huyết tương “chứng”). Nếu:

  • APTT của mẫu huyết tương trộn điều chỉnh về bình thường nghĩa là APTT của người bệnh kéo dài do thiếu hụt một hoặc nhiều yếu tố đông máu.
  • APTT của mẫu trộn (sau khi ủ 37 OC trong 2h) không điều chỉnh về bình thường nghĩa là APTT của người bệnh kéo dài do có chất ức chế phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh.

II. CHỈ ĐỊNH

  • Là xét nghiệm cần tiến hành tiếp theo khi kết quả xét nghiệm APTT kéo dài.
  • Theo dõi điều trị người bệnh có chất ức chế phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện: 1 kỹ thuật viên xét nghiệm;

1 bác sĩ duyệt kết quả.

2. Phương tiện, hóa chất:

  • Tủ lạnh;
  • Máy ly tâm;
  • Bình cách thủy 37OC;
  • Máy đông máu bán tự động/tự động;
  • Đồng hồ bấm giây;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm tan máu kích thước 75 x 9,5mm;
  • Ống nghiệm plastic có chống đông citrat natri 3,2% hoặc 3,8%;
  • Pipette 100 – 1000^1;
  • Nước cất;
  • Hóa chất xét nghiệm APTT (tùy theo loại máy xét nghiệm đông máu);
  • Normal pool plasma.

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, giường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

– Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh và 2ml máu tĩnh mạch của người làm chứng bình thường – huyết tương “chứng” (nếu không có mẫu chứng thương mại – Normal pool plasma);

– Trộn đều máu với chất chống đông citrate natri 3,2% hoặc 3,8% theo tỷ lệ 1 thể tích chống đông trộn với 9 thể tích máu;

– Ly tâm mạnh để thu huyết tương nghèo tiểu cầu của người bệnh và chứng;

– Tiến hành xét nghiệm APTT đồng thời với 3 mẫu huyết tương trong cùng điều kiện:

+ Mẫu 1: huyết tương “chứng”;

+ Mẫu 2: huyết tương bệnh;

+ Mẫu 3: huyết tương hỗn hợp “bệnh + chứng” (tỷ lệ 1:1).

– Ghi thời gian đông của cả 3 mẫu.

– Ủ cả 3 mẫu trên trong 2 giờ trong bình cách thủy 37OC.

– Tiến hành xét nghiệm APTT đồng thời với cả 3 mẫu đã ủ trong cùng điều kiện:

+ Mẫu 1: huyết tương “chứng”;

+ Mẫu 2: huyết tương bệnh;

+ Mẫu 3: huyết tương hỗn hợp “bệnh + chứng” (tỷ lệ 1:1).

– Ghi thời gian đông của 3 mẫu sau khi ủ.

VI. NHẬN ĐỊNH KẾT QUẢ

– APTT của hỗn hợp “bệnh + chứng” trước và sau ủ 37oC/2h có điều chỉnh về bình thường: kháng đông phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh âm tính.

– APTT của hỗn hợp “bệnh + chứng” trước ủ 37oC/2h điều chỉnh về bình thường và sau ủ 37oC/2h không điều chỉnh về bình thường: kháng đông phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh dương tính.

– Ghi kết quả vào giấy xét nghiệm;

– Ghi ngày, tháng, năm tiến hành xét nghiệm.

– Bác sỹ nhận định kết quả ký tên vào vị trí người duyệt kết quả xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

  • Mẫu máu bị đông, để >4h từ khi lấy máu đến khi làm xét nghiệm.
  • Mẫu huyết tương “chứng” không đảm bảo chất lượng;
  • Mẫu huyết tương hỗn hợp “bệnh + chứng” không đảm bảo tỷ lệ.
  • Các mẫu huyết tương bệnh, chứng, hỗn hợp “bệnh + chứng” không được tiến hành xét nghiệm APTT cùng thời điểm, cùng hóa chất.
  • Thời gian ủ mẫu chưa đủ.
  • Nhiệt độ bình cách thủy không đủ 37oC.

PHÁT HIỆN CHẤT ỨC CHẾ KHÔNG PHỤ THUỘC THỜI GIAN VÀ NHIỆT ĐỘ ĐƯỜNG ĐÔNG MÁU NỘI SINH

(Intrinsic coagulation pathway inhibitor without time and temperature dependence)

I. NGUYÊN LÝ

Xét nghiệm APTT (Actived Partial Thromboplastin Time) giúp đánh giá các yếu tố tham gia đường đông máu nội sinh. Xét nghiệm APTT kéo dài có thể do 1 trong 2 nhóm nguyên nhân chính sau:

– Do thiếu một hoặc nhiều yếu tố tham gia đường đông máu nội sinh.

– Do có chất ức chế một hoặc nhiều yếu tố tham gia đường đông máu nội sinh.

Tiến hành xét nghiệm APTT với mẫu huyết tương trộn theo tỷ lệ 1:1 giữa huyết tương người bệnh và huyết tương bình thường (huyết tương “chứng”). Nếu:

– APTT của mẫu huyết tương trộn điều chỉnh về bình thường nghĩa là APTT của người bệnh kéo dài do thiếu hụt một hoặc nhiều yếu tố đông máu.

– APTT của mẫu trộn không điều chỉnh về bình thường (cả trước và sau khi ủ trong 2h ở 37 °C) nghĩa là APTT của người bệnh kéo dài do có chất ức chế không phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh.

II. CHỈ ĐỊNH

  • Là xét nghiệm cần tiến hành tiếp theo khi kết quả xét nghiệm APTT kéo dài.
  • Theo dõi điều trị người bệnh có kháng đông không phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • 1 kỹ thuật viên xét nghiệm;
  • 1 bác sĩ duyệt kết quả.

2. Phương tiện, hóa chất

  • Tủ lạnh;
  • Máy ly tâm;
  • Bình cách thủy 37OC;
  • Máy đông máu bán tự động/ tự động;
  • Đồng hồ bấm giây;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm tan máu kích thước 75 x 9,5mm;
  • Ống nghiệm plastic có chống đông citrat natri 3,2% hoặc 3,8%;
  • Pipette 100^1;
  • Nước cất;
  • Hóa chất xét nghiệm APTT (tùy theo loại máy xét nghiệm đông máu);
  • Normal pool plasma.

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi rõ trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, gường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

– Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh và 2ml máu tĩnh mạch của người bình thường để làm huyết tương “chứng” (nếu không có mẫu chứng thương mại -Normal pool plasma);

– Trộn đều máu với chất chống đông citrate natri 3,2% hoặc 3,8% theo tỷ lệ 1 thể tích chống đông trộn với 9 thể tích máu;

– Ly tâm mạnh để thu huyết tương nghèo tiểu cầu của người bệnh và chứng;

– Tiến hành xét nghiệm APTT đồng thời với 3 mẫu huyết tương trong cùng điều kiện:

+ Mẫu 1: huyết tương chứng;

+ Mẫu 2: huyết tương bệnh;

+ Mẫu 3: huyết tương hỗn hợp “bệnh + chứng” theo tỷ lệ 1:1.

VI. NHẬN ĐỊNH VÀ TRẢ KẾT QUẢ

– APTT của hỗn hợp “bệnh + chứng” điều chỉnh về bình thường: kháng đông không phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh âm tính.

– APTT của hỗn hợp “bệnh + chứng” không điều chỉnh về bình thường: kháng đông không phụ thuộc thời gian và nhiệt độ đường đông máu nội sinh dương tính.

– Ghi kết quả vào giấy xét nghiệm;

– Ghi ngày, tháng, năm tiến hành xét nghiệm.

– Bác sỹ nhận định kết quả ký tên vào vị trí người duyệt xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

– Mẫu máu bị đông, để >4h từ khi lấy máu đến khi làm xét nghiệm.

– Mẫu huyết tương chứng không đảm bảo chất lượng;

– Mẫu huyết tương hỗn hợp “bệnh + chứng” không đảm bảo tỷ lê.

– Các mẫu huyết tương bệnh, chứng, hỗn hợp “bệnh + chứng” không được tiến hành xét nghiệm APTT cùng thời điểm, cùng hóa chất.

ĐỊNH LƯỢNG KHÁNG THỂ KHÁNG β2GLYCOPROTEIN IgM – IgG
BẰNG KỸ THUẬT HÓA MIỄN DỊCH PHÁT QUANG

(Anti-β2 Glycoprotein-I IgM/IgG antibodies
in chemiluminescent immunoassay)

I. NGUYÊN LÝ

Kháng thể kháng β2- glycoprotein I IgG, IgM (β2 GP I- IgM/ IgG) là các kháng thể thường gặp trong hội chứng kháng phospholipid.

Phát hiện kháng thể kháng β2 GP I (IgM/ IgG) bằng kỹ thuật hóa miễn dịch phát quang bằng cách sử dụng các phân tử β2GPI (IgM, IgG) của người, đã được tinh chế, có gắn các phân tử từ tính. Các phân tử β2GPI gắn từ tính sẽ kết hợp với kháng thể kháng β2GPI có trong huyết tương người bệnh. Sau đó kháng kháng thể β2GPI gắn chất phát quang được bổ sung vào hỗn hợp trên. Phản ứng giữa β2GPI (có gắn từ tính) – kháng thể β2GPI – kháng kháng thể (có gắn chất phát quang)” xảy ra. Phản ứng phát quang được hoạt hóa với H2O2 và chất xúc tác. Mức độ phát quang được đo thông qua hệ thống quang học sẽ tỷ lệ thuận với nồng độ kháng thể trong mẫu huyết tương của người bệnh.

II. CHỈ ĐỊNH

Chẩn đoán và theo dõi điều trị các trường hợp nghi ngờ có hội chứng kháng phospholipid (nguyên phát hoặc thứ phát).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • 1 kỹ thuật viên xét nghiệm.
  • 1 bác sỹ duyệt kết quả.

2. Phương tiện, hóa chất

  • Máy xét nghiệm đông máu (có phương pháp phân tích theo cơ chế hóa miễn dịch phát quang);
  • Tủ lạnh;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm plastic có chống đông citrat natri (3,2% hoặc 3,8%) hoặc ống không có chất chống đông;
  • Hóa chất: aβ2GPI IgM/ IgG.

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, giường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

  • Bật máy máy xét nghiệm đông máu, chờ đủ nhiệt độ;
  • Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh;
  • Trộn máu và chất chống đông citrat natri 3,2% hoặc 3,8% (tỷ lệ 1 thể tích chống đông: 9 thể tích máu);
  • Ly tâm mạnh để thu huyết tương nghèo tiểu cầu hoặc huyết thanh;
  • Tiến hành xét nghiệm theo quy trình xét nghiệm trên máy.

VI. NHẬN ĐỊNH KẾT QUẢ

  • In kết quả vào giấy xét nghiệm;
  • Ghi ngày, tháng, năm tiến hành xét nghiệm.
  • Bác sỹ nhận định kết quả ký tên vào vị trí người duyệt kết quả xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

  • Tiến hành xét nghiệm quá 4h từ khi lấy máu.
  • Mẫu máu bị đông dây.
  • Hóa chất hết hạn sử dụng.

ĐỊNH LƯỢNG KHÁNG THỂ KHÁNG CARDIOLIPIN IgM – IgG BẰNG KỸ THUẬT HÓA MIỄN DỊCH PHÁT QUANG

(Anti-β2 Cardiolipin-I IgM/IgG antibodies in chemiluminescent immunoassay)

I. NGUYÊN LÝ

Kháng thể kháng Cardiolipin IgM/IgG (aCL – IgM/IgG) là các kháng thể thường gặp trong hội chứng kháng phospholipid.

Phát hiện kháng thể kháng aCL – IgM/IgG theo kỹ thuật hóa miễn dịch phát quang bằng cách sử dụng các phân tử aCL – IgM/IgG của người, đã được tinh chế, có gắn các phân tử từ tính. Các phân tử aCL – IgM/IgG gắn từ tính sẽ kết hợp với kháng thể kháng aCL có trong huyết tương người bệnh. Sau đó kháng kháng thể aCL gắn chất phát quang được bổ sung. Phản ứng giữa “aCL (có gắn từ tính) – kháng thể aCL – kháng kháng thể (có gắn chất phát quang)” xảy ra. Phản ứng phát quang được hoạt hóa với H2O2 và chất xúc tác. Mức độ phát quang được đo thông qua hệ thống quang học sẽ tỷ lệ thuận với nồng độ kháng thể trong mẫu huyết tương của người bệnh.

II. CHỈ ĐỊNH

Chẩn đoán và theo dõi điều trị các trường hợp nghi ngờ có hội chứng kháng phospholipid (nguyên phát hoặc thứ phát).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • 1 kỹ thuật viên xét nghiệm.
  • 1 bác sỹ duyệt kết quả.

2. Phương tiện, hóa chất

  • Máy xét nghiệm đông máu (có phương pháp phân tích theo cơ chế hóa miễn dịch phát quang);
  • Tủ lạnh;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm plastic có chống đông citrat natri (3,2% hoặc 3,8%) hoặc ống không có chất chống đông;
  • Hóa chất: aCL IgM/ IgG.

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, giường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

  • Bật máy xét nghiệm đông máu, chờ đủ nhiệt độ;
  • Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh.
  • Trộn máu và chất chống đông citrat natri 3,2% hoặc 3,8% (tỷ lệ 1 thể tích chống đông: 9 thể tích máu) hoặc sử dụng ống không chống đông.
  • Ly tâm mạnh để thu huyết tương nghèo tiểu cầu hoặc huyết thanh.
  • Tiến hành xét nghiệm theo quy trình xét nghiệm trên máy.

VI. NHẬN ĐỊNH KẾT QUẢ

  • In kết quả vào giấy xét nghiệm;
  • Ghi ngày, tháng, năm tiến hành xét nghiệm.
  • Bác sỹ nhận định kết quả ký tên vào vị trí người duyệt kết quả xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

  • Tiến hành xét nghiệm quá 4h từ khi lấy máu.
  • Mẫu máu bị đông dây.
  • Hóa chất hết hạn sử dụng.

ĐỊNH LƯỢNG KHÁNG NGUYÊN YẾU TỐ XIII

(Factor XIII antigen assay)

I. NGUYÊN LÝ

Yếu tố XIII giúp hình thành các liên kết chéo giữa các fibrin monomer hòa tan (không bền vững) để hình thành fibrin polymer không hòa tan (bền vững), do đó có tác dụng làm ổn định cục máu đông. Kháng nguyên yếu tố XIII có trong huyết tương người bệnh sẽ được gắn với kháng thể đơn dòng kháng kháng nguyên yếu tố XIII và được tăng cường bởi các hạt latex. Mức độ đục của hỗn hợp kháng nguyên – kháng thể có gắn hạt latex tỷ lệ thuận với nồng độ kháng nguyên yếu tố XIII có trong huyết tương người bệnh.

II. CHỈ ĐỊNH

  • Chẩn đoán các trường hợp nghi ngờ thiếu yếu tố XIII (bẩm sinh, mắc phải).
  • Theo dõi điều trị thiếu yếu tố XIII (bẩm sinh, mắc phải).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

  • 1 kỹ thuật viên xét nghiệm.
  • 1 bác sỹ duyệt kết quả.

2. Phương tiện, hóa chất

  • Máy xét nghiệm đông máu tự động;
  • Tủ lạnh;
  • Bơm tiêm nhựa lấy máu;
  • Bông cồn sát trùng, dây garo;
  • Ống nghiệm plastic có chống đông citrat natri 3,2% hoặc 3,8%;
  • Normal pool plasma;
  • Hóa chất Factor XIII Antigen kit: Latex Reagent, Buffer, Diluent.

3. Người bệnh

Không cần chuẩn bị gì đặc biệt.

4. Hồ sơ bệnh án

Chỉ định xét nghiệm được ghi trong bệnh án; Giấy chỉ định xét nghiệm ghi đầy đủ thông tin về người bệnh: họ tên, tuổi, gường bệnh, khoa phòng, chẩn đoán.

V. CÁC BƯỚC TIẾN HÀNH

  • Bật máy xét nghiệm đông máu, chờ đủ nhiệt độ.
  • Garo, sát trùng, lấy 2ml máu tĩnh mạch của người bệnh.
  • Trộn máu và chất chống đông citrat natri 3,2% hoặc 3,8% (tỷ lệ 1 thể tích chống đông : 9 thể tích máu).
  • Ly tâm mạnh để thu huyết tương nghèo tiểu cầu.
  • Tiến hành QC hóa chất trước khi tiến hành xét nghiệm.
  • Tiến hành chạy mẫu bệnh phẩm theo quy trình xét nghiệm trên máy.

VI. NHẬN ĐỊNH KẾT QUẢ

  • In kết quả vào giấy xét nghiệm;
  • Ghi ngày, tháng, năm tiến hành xét nghiệm.
  • Bác sỹ nhận định kết quả ký tên vào vị trí người duyệt kết quả xét nghiệm.

VII. NGUYÊN NHÂN SAI SÓT

  • Tiến hành xét nghiệm quá 4h từ khi lấy máu.
  • Mẫu máu bị đông dây.
  • Hóa chất không đảm bảo chất lượng.

TÀI LIỆU THAM KHẢO

  1. Đỗ Trung Phấn (2013). Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng. Nhà xuất bản Y học.
  2. John P. Greer (2014). Wintrobe’s clinical hematology, 13th edition. Lippincott Williams and Wilkins.
  3. Tem Innovations GmbH. ROTEM Delta operating manual.

CHƯƠNG III : MIỄN DỊCH – DI TRUYỀN – SINH HỌC PHÂN TỬ

ANA 17 PROFILE TEST (SÀNG LỌC VÀ ĐỊNH DANH ĐỒNG THỜI 17 TYP KHÁNG THỂ KHÁNG NHÂN BẰNG SẮC KÝ MIỄN DỊCH)

I. NGUYÊN LÝ

Kháng nguyên (KN) được gắn sẵn trên màng của strip. Các KN kết hợp với kháng thể (KT) đặc hiệu (nếu có) trong huyết thanh người bệnh tạo nên phức hợp KN – KT khi ủ. Sau khi rửa sạch, phức hợp này sẽ được gắn tiếp với KT kháng globulin miễn dịch người (anti IgG) đã kết hợp sẵn enzym peroxidase. Sau khi rửa, lượng enzym gắn với phức hợp này được giữ lại trong giếng. Khi cho cơ chất TMB/ H2O2 enzym sẽ xúc tác tạo phản ứng tạo màu xanh. Sau đó ngừng phản ứng tạo màu bằng nước cất, đọc kết quả.

II. CHỈ ĐỊNH

Các trường hợp ngh đến bệnh tự miễn.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên và cử nhân đã được đào tạo thực hiện kỹ thuật;

– Bác sĩ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện – Hóa chất

2.1. Phương tiện

  • Máy ly tâm ống máu;
  • Pipet và đầu côn dùng được cho 10µl, 300 μ1, 700μl, 1000μl;
  • Pipet nhựa;
  • Găng tay.

2.2. Hóa chất

  • Dung dịch Wash Buffer 20X (pha thành dung dịch 1X bằng nước cất);
  • Dung dịch đệm mẫu (10m1 Wash Buffer 1X + 1 1ọ B1ocking Reagent);
  • Dung dịch cộng hợp (Conjugates);
  • Cơ chất tạo mầu (TMB substrate);
  • 24 strips;
  • 24 rãnh ủ;
  • Bảng tham chiếu;
  • Nước cất, hoá chất khử trùng Natri hypoclorite.

3. Mẫu bệnh phẩm

  • Mẫu dùng là huyết thanh.
  • Cần tách huyết thanh càng sớm càng tốt để tránh hiện tượng tan máu làm ảnh hưởng đến kết quả phản ứng.
  • Nếu có lẫn hồng cầu hoặc những thành phần hữu hình trong mẫu huyết thanh thì cần ly tâm mẫu để loại bỏ các thành phần đó trước khi xét nghiệm.
  • Mẫu huyết thanh bảo quản ở nhiệt độ 2°C đến 8°C có thể dùng làm xét nghiệm trong vòng 7 ngày. Nếu muốn để lâu hơn mới xét nghiệm cần phải bảo quản ở tủ lạnh sâu (≤ -20°C). Tuy nhiên với mẫu bảo quản lạnh sâu cần tránh đông-tan nhiều lần.

V. CÁC BƯỚC TIẾN HÀNH

1. Đặt strip (Strip cho người bệnh, Strip chứng âm, Strip chứng dương) vào rãnh ủ.

2. Cho 700µl Wash buffer 1X và 300µl Sample buffer vào rãnh ủ. Làm ẩm strip với dung dịch và ủ trong vòng 5 phút, lắc đều.

3. Hút 10µl mẫu huyết thanh vào rãnh ủ, trộn đều. Ủ 30 phút ở 20-32°C, lắc đều (5 phút lắc 1lần). Hút bỏ hoàn toàn dung dịch trong rãnh.

4. Rửa 1 lần (1x 1,5ml Wash buffer 1X) trong vòng 5 phút, lắc đều. Hút bỏ hoàn toàn dung dịch rửa. Lặp lại bước rửa 2 lần.

5. Hút 700 µl Wash buffer 1X và 300 µl Conjugate vào rãnh ủ, lắc đều. Ủ 30 phút ở 20-32°C, lắc đều (5 phút lắc 1 lần). Hút bỏ hoàn toàn dung dịch trong rãnh.

6. Rửa 1 lần (1x 1,5ml Wash buffer 1X) trong vòng 5 phút, lắc đều. Hút bỏ hoàn toàn dung dịch rửa. Lặp lại bước rửa 2 lần.

7. Hút 700 µl nước cất và 300 µl cơ chất hiện màu vào rãnh ủ, lắc đều. Ủ 15 phút ở 20-32°C, lắc đều (5 phút lắc 1 lần), tránh ánh sáng. Hút bỏ hoàn toàn dung dịch trong rãnh.

8. Hút 2 ml dung dịch nước cất vào rãnh ủ. Ủ 1 phút, lắc đều. Hút bỏ hoàn toàn dung dịch trong rãnh. Lặp lại bước này một lần nữa.

9. Bỏ strip ra khỏi rãnh ủ. Làm khô strip bằng giấy lọc.

10. Phân tích kết quả trong vòng 24h.

VI. NHẬN ĐỊNH KẾT QUẢ

– Kết quả của test có thể coi là hợp lệ, nếu:

+ Functional control có thể nh n thấy được;

+ Cut-off control có thể nh n thấy được;

+ Cường độ màu sắc của cut-off control yếu hơn so với Functional control;

+ Chứng m tính, chứng dương tính.

– Đặt strip lên bảng tham chiếu sao cho băng tại vị trí của Functional control, Cut-off control trên strip khớp với băng trên bảng tham chiếu.

– So sánh cường độ màu sắc của các băng với cường độ màu của cut-off control:

+ Nếu cường độ màu sắc mạnh hơn th kết quả xét nghiệm là dương tính;

+ Nếu cường độ màu sắc là yếu hơn th xét nghiệm là m tính.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy chỉ định xét nghiệm và trên ống máu không thống nhất, máu bị đông.

Xử trí: yêu cầu nơi đưa mẫu xác minh lại thông tin trên giấy chỉ định và trên ống nghiệm, nếu cần phải lấy lại mẫu bệnh phẩm.

– Sai sót do nhỏ mẫu vào rãnh không thống nhất thông tin về thứ tự người bệnh và thứ tự mẫu phân tích.

Xử trí: Vẽ sơ đồ nhỏ mẫu trước khi làm xét nghiệm. Kiểm tra đối chiếu thông tin vị trí nhỏ mẫu trước khi nhỏ mẫu.

– Chứng dương âm tính hoặc chứng âm dương tính: Nếu xảy ra hiện tượng này đều không dùng được kết quả của lần xét nghiệm này. Nguyên nhân có thể do hóa chất không đảm bảo chất lượng, do không thực hiện đủ và đúng các bước trong quy trình xét nghiệm, nhiệt độ phản ứng không phù hợp, thực hiện bước rửa kém hiệu quả. Để
strip khô trong bước ủ, để ngón tay chạm vào strip, nhỏ hóa chất trực tiếp vào strip.

Xử trí: làm lại xét nghiệm, kiểm tra chỉ dùng hóa chất còn hạn sử dụng và được bảo quản đúng điều kiện theo hướng đãn của nhà sản xuất, tuân thủ đúng các bước quy trình, kiểm soát tốt nhiệt độ phòng xét nghiệm (20-32°C).

TÀI LIỆU THAM KHẢO

Aesku Diagnostics GmbH. AESKUBLOT ANA-17 Pro instruction manual.

ĐỊNH LƯỢNG IL-2R (HAY CD25 HÒA TAN) TRONG HUYẾT THANH BẰNG KỸ THUẬT MIỄN DỊCH GẮN MEN (ELISA)

(IL-2R quantitative test by ELISA)

I. NGUYÊN LÝ

Kháng thể (KT) kháng IL-2R người được hấp phụ vào giếng xét nghiêm. Khi thêm huyết thanh người bệnh vào giếng xét nghiệm, IL-2R trong huyết thanh người bệnh được gắn đặc hiệu lên các KT này trong giếng, tạo nên phức hợp KN – KT. Kháng thể kháng IL-2R người kết hợp với HRP (có enzyme peroxidase) được thêm vào ở bước tiếp theo sẽ gắn tiếp tục lên IL-2R trong mẫu huyết thanh. Sau khi ủ và rửa, các kháng thể thừa được loại bỏ. Dung dịch cơ chất được thêm vào giếng, phản ứng với HRP tạo màu. Sản phẩm màu được tạo ra tương ứng với lượng IL-2 có mặt trong mẫu huyết thanh. Phản ứng kết thúc khi thêm dung dịch dừng phản ứng (có chứa acid). Đo mật độ quang (OD) ở bước sóng 450 nm. Một đường cong chuẩn được hình thành từ 7 mẫu IL-2R chuẩn (đã biết nồng độ) được pha loãng. Đường chuẩn này được thiết lập với mỗi phiến xét nghiệm. Nồng độ IL-2R của mẫu huyết thanh được xác định dựa trên đường chuẩn này.

II. CHỈ ĐỊNH

Các trường hợp có sự gia tăng hoạt tính của tế bào lympho T: Hội chứng thực bào tế bào máu, Lơ xê mi tế bào tóc, U lympho Hodgkin, không Hodgkin; các bệnh tự miễn hoặc nhiễm khuẩn như bệnh Kawasaki, Xơ cứng bì rải rác, bệnh Lupus ban đỏ hệ thống; bệnh lý thải ghép,…

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện:

– Kỹ thuật viên và cử nhân đã được đào tạo thực hiện kỹ thuật;

– Bác sĩ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện – Hóa chất

2.1. Phương tiện

– Máy ly tâm ống máu;

– Pipet và đầu pipet loại 25µl và 1000μl;

– Dàn máy ELISA (tự động hoặc bán tự động);

Găng tay.

2.2. Hóa chất

Kít định lượng IL-2R gồm các thành phần sau:

– Phiến xét nghiệm 96 giếng có phủ KT đơn dòng kháng IL-2R người (Coated Microwell Strips): phiến được đựng trong túi bạc.

– Dung dịch cộng hợp- Kháng thể đơn dòng kháng IL-2R người kết hợp HRP (HRP conjugate): lọ 70ul, nắp vàng.

– IL-2R người đông khô, sau tái hòa tan đạt nồng độ 40ng/ml (sIL-2R Standard): 2 lọ 250ul, nắp màu xanh.

– Dung dịch pha loãng mẫu (Sample Diluent): lọ 12ml, nắp màu đen.

– Dung dịch đệm 20x, chứa dung dịch PBS 1% -20% và 10% BSA (Assay Buffer Concentrate 20x): lọ 5ml, nắp trắng.

– Dung dịch đệm rửa 20x, chứa PBS 1%-20% (Wash buffer concentrate 20x): lọ 50ml, nắp đen.

– Dung dịch cơ chất tetramethyl-benzidin (Substrate Solution): lọ 15ml, nắp xanh.

– Dung dịch dừng phản ứng, chứa dung dịch acid phosphoric 1M (Stop solution): lọ 15ml, nắp vàng.

– Miếng dán (Adhesive Films): gồm 2 miếng dán được đóng gói trong bao nilon;

Hóa chất khác: Nước cất, hoá chất khử trùng Natri hypoclorite.

3. Mẫu bệnh phẩm

– Mẫu dùng là huyết thanh.

– Cần tách huyết thanh càng sớm càng tốt để tránh hiện tượng tan máu làm ảnh hưởng đến kết quả phản ứng.

– Nếu có lẫn hồng cầu hoặc những thành phần hữu hình trong mẫu huyết thanh thì cần ly tâm mẫu để loại bỏ các thành phần đó trước khi xét nghiệm.

– Mẫu huyết thanh bảo quản ở nhiệt độ 2°C đến 8°C có thể dùng làm xét nghiệm trong vòng 7 ngày. Nếu muốn để lâu hơn mới xét nghiệm cần phải bảo quản ở tủ lạnh sâu (≤ -20°C). Tuy nhiên với mẫu bảo quản lạnh sâu cần tránh đông-tan nhiều lần.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị giếng: rửa phiến 2 lần với 400ul dung dịch đệm rửa, cách nhau 10- 15 giây.

2. Pha dung dịch pha loãng 20X (sample buffer) thành dung dịch 1X. VD 20ml dung dịch 1X (1ml dung dịch 20X + 19ml nước cất H2O).

3. Pha IL-2R người đông khô về đúng nồng độ 40ng/ml.

4. Nhỏ 100ul dung dịch pha loãng mẫu vào các giếng chuẩn. Nhỏ 50ul dung dịch pha loãng mẫu vào giếng xét nghiệm. Nhỏ 50ul huyết thanh vào giếng xét nghiệm.

5. Thêm 50ul dung dịch cộng hợp.

6. Ủ 30 phút ở nhiệt độ phòng.

7. Rửa 3 lần bằng dung dịch rửa, 400µl/giếng/lần.

8. Nhỏ 100µl cơ chất tạo mầu (TMB subtrate) vào mỗi giếng.

9. Ủ 30 phút ở nhiệt độ phòng, tránh ánh sáng.

10. Nhỏ 100µl dung dịch dừng phản ứng (stop solution) vào mỗi giếng theo đúng trình tự nhỏ TMB.

11. Đọc phiến ở bước sóng 450/620 nm (tốt hơn thì dùng bước sóng kép 450/ 620 nm) trong vòng 30 phút sau khi ủ dung dịch ngừng phản ứng.

12. Phân tích kết quả.

VI. NHẬN ĐỊNH KẾT QUẢ

– Căn cứ vào nồng độ chuẩn được xác định khi thực hiện xét nghiệm với 7 mẫu IL-2R đã được chuẩn bị, thiết lập đường cong chuẩn.

Quyết định số 3336/QĐ-BYT ngày 20/07/2017 của Bộ Y tế về việc ban hành tài liệu Hướng dẫn quy trình kỹ thuật Huyết học - Truyền máu - Miễn dịch - Di truyền - Sinh học phân tử

– Giá trị biện luận: Dựa trên đường cong chuẩn được thiết lập, tính toán giá trị IL-2R của mẫu huyết thanh.

Giá trị IL-2R > 2400U/l có ý nghĩa trong việc chẩn đoán xác định hội chứng thực bào tế bào máu.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy chỉ định xét nghiệm và trên ống máu không thống nhất, máu bị đông.

Xử trí: yêu cầu nơi đưa mẫu xác minh lại thông tin trên giấy chỉ định và trên ống nghiệm, nếu cần phải lấy lại mẫu bệnh phẩm.

– Sai sót do nhỏ mẫu vào phiến phản ứng không thống nhất thông tin về thứ tự người bệnh và thứ tự mẫu phân tích.

Xử trí: Vẽ sơ đồ nhỏ mẫu trước khi làm xét nghiệm. Kiểm tra đối chiếu thông tin vị trí nhỏ mẫu trước khi nhỏ mẫu.

– Chứng dương âm tính hoặc chứng âm dương tính: Nếu xảy ra hiện tượng này đều không dùng được kết quả của lần xét nghiệm này. Nguyên nhân có thể do hóa chất không đảm bảo chất lượng, do không thực hiện đủ và đúng các bước trong quy trình xét nghiệm, nhiệt độ phản ứng không phù hợp, thực hiện bước rửa kém hiệu quả.

Xử trí: làm lại xét nghiệm, kiểm tra chỉ dùng hóa chất còn hạn sử dụng và được bảo quản đúng điều kiện theo hướng đãn của nhà sản xuất, tuân thủ đúng các bước quy trình, kiểm soát tốt nhiệt độ phòng xét nghiệm (25-30°C).

TÀI LIỆU THAM KHẢO

1. Abnova Diagnostics. ABNOVA instruction manual.

XÉT NGHIỆM KHÁNG THỂ KHÁNG TIỂU CẦU TRỰC TIẾP VÀ GIÁN TIẾP BẰNG KỸ THUẬT FLOW CYTOMETRY

I. NGUYÊN LÝ

– Trên bề mặt tiểu cầu có các kháng nguyên tiểu cầu HPA, kháng nguyên bạch cầu HLA và kháng nguyên nhóm máu ABO. Trong những điều kiện nhất định, có thể có thể sinh các tự kháng thể chống lại các kháng nguyên tiểu cầu của chính mình (bệnh giảm tiểu cầu miễn dịch) hoặc sinh kháng thể đồng loại chống các kháng nguyên tiểu cầu truyền vào. Các kháng thể kháng tiểu cầu có thể tồn tại tự do trong huyết tương hoặc đã gắn trên bề mặt tiểu cầu. Hầu hết các kháng thể này là kháng thể miễn dịch có bản chất là IgG.

– Dùng kháng thể đơn dòng gắn huỳnh quang kháng IgG người có thể phát hiện được kháng thế kháng tiểu cầu trực tiếp (kháng thể đã gắn lên tiểu cầu) hoặc kháng thể kháng tiểu cầu gián tiếp (kháng thể tự do trong huyết tương).

II. CHỈ ĐỊNH

– Người bệnh xuất huyết giảm tiểu cầu nghi do miễn dịch;

– Người bệnh truyền máu, tiểu cầu nhiều lần;

– Người bệnh truyền tiểu cầu không hiệu lực.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên, cử nhân đã được đào tạo thực hiện kỹ thuật;

– Bác sỹ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện hóa chất

2.1. Phương tiện

– Máy phân tích tế bào dòng chảy (máy flow cytometry);

– Máy ly tâm;

– Máy lắc trộn (máy votex);

– Pipet và đầu pipet các loại 250 và 1.000 microlit;

– Các ống nghiệm chuyên dụng cho flow cytometry;

Găng tay làm xét nghiệm.

2.2. Hóa chất

– Anti CD61-PE;

– Anti human IgG-FITC;

– Anti human IgM-FITC;

– Dung dịch PBS-EDTA;

– Dung dịch sheath chạy máy flow;

– Nước cất, hóa chất khử trùng Natri hypoclorite;

– Mẫu chứng âm: lag mẫu huyết thanh người không có kháng thể kháng tiểu cầu;

– Mẫu chứng dương: là mẫu huyết thanh người có kháng thể kháng tiểu cầu;

– 5 mẫu tiểu cầu của người cho máu cùng nhóm ABO với người bệnh.

3. Bệnh phẩm

Cần 2 mẫu máu (1 mẫu chống đông natri citrate, 1 mẫu đông) lấy từ người bệnh có chỉ định làm xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

– Người bệnh: 2 ml máu chống đông bằng natri citrate; 2 ml máu đông;

– 5 mẫu tiểu cầu người cho cùng nhóm ABO của người bệnh (lấy từ các dây tiểu cầu của túi tiểu cầu trong ngân hàng máu;

– Mẫu chưa làm ngay có thể giữ trong tủ lạnh 2-8°C trong vòng 3 ngày.

2. Tiến hành kỹ thuật

2.1. Với xét nghiệm kháng thể kháng tiểu cầu trực tiếp

– Chuẩn bị bệnh phẩm

+ Ly tâm ống máu người bệnh chống đông bằng natri citrate để tách huyết tương giầu tiểu cầu: ly tâm 500 vòng/phút trong 15 phút ở nhiệt độ thường.

+ Rửa tiểu cầu 2 lần bằng dung dịch PBS-EDTA: ly tâm 3000 vòng/phút trong 5 phút.

+ Pha huyền dịch tiểu cầu trong PBS-EDTA nồng độ 1 x10^7/ml.

– Ủ kháng thể

+ Ủ 100 microlit huyền dịch tiểu cầu với các kháng thể đơn dòng theo sơ đồ sau. Thời gian ủ 20 phút ở nhiệt độ phòng, tránh ánh sang. Sơ đồ ủ mẫu như sau:

Ống số Tiêu cầu BN Anti CD61-PE Anti mouse IgG-PE Anti mouse IgG-FITC Anti human IgG-FITC
1 100 μι 20 μι 20 μι
2 100 μι 20 μι 20 μι
3 100 μι 20 μι 20 μι

+ Sau ủ kháng thể, rửa bỏ kháng thể thừa 2 lần bằng dung dịch PBS-EDTA, ly tâm 3000 vòng/phút x 5 phút. Đổ bỏ dịch nỗi giữ lại cặn tế bào.

+ Sau rửa, tái huyền dịch tiểu cầu trong 1 ml dung dịch PBS-EDTA và trộn đều. Lúc này ống đã sẵn sang cho phân tích.

2.2. Với xét nghiệm kháng thể kháng tiểu cầu gián tiếp

– Chuẩn bị bệnh phẩm

+ Chuẩn bị tiểu cầu giá thể:

• Trộn 5 mẫu tiểu cầu cùng nhóm ABO người bệnh với tỷ lệ tương đương.

• Rửa tiểu cầu 2 lần bằng dung dịch PBS-EDTA: ly tâm 3000 vòng/phút trong 5 phút.

• Pha huyền dịch tiểu cầu trong PBS-EDTA nồng độ 1 x10^7/ml.

+ Tách huyết thanh người bệnh từ ống máu đông

+ Mẫn cảm tiểu cầu giá thể

+ Ủ 100 microlit tiểu cầu giá thể với huyết thanh chứng âm, huyết thanh chứng dương và huyết thanh người bệnh theo sơ đồ sau

Ống số Tiểu cầu giá thể Huyết thanh chứng Dương Huyết thanh người bệnh
4 100 μι
5 100 μι 20 μι
6 100 μι 20 μι
7 100 μι 20 μι
8 100 μι 20 μι

• Ủ 60 phút ở 37°, trong tối.

• Sau ủ rửa tiểu cầu giá thể đã mẫn cảm huyết thanh người bệnh bằng dung dịch PBS-EDTA, ly tâm 3.000 vòng/phút x 5 phút.

• Tái huyền dịch cặn tiểu cầu trong các ống 3, 4, 5, 6 trong 100 µl BPS-EDTA.

– Ủ kháng thể

+ Ủ 100 microlit huyền dịch tiểu cầu với các kháng thể đơn dòng theo sơ đồ sau. Thời gian ủ 20 phút ở nhiệt độ phòng, tránh ánh sáng.

Ống số Tiểu cầu giá thể đã mẫn cảm huyết thanh người bệnh  Anti CD61- PE Anti mouse IgG-PE Anti mouse IgG-FITC Anti human IgG-FITC
4 100 μι 20 μι 20 μι
5 100 μι 20 μι 20 μι
6 100 μι 20 μι 20 μι
7 100 μι 20 μι 20 μι
8 100 μι 20 μι 20 μι

 

+ Sau ủ kháng thể, rửa bỏ kháng thể thừa 2 lần bằng dung dịch PBS-EDTA, ly tâm 3000 vòng/phút x 5 phút. Đổ bỏ dịch nỗi giữ lại cặn tế bào.

+ Sau rửa, tái huyền dịch tiểu cầu trong 1 ml dung dịch PBS-EDTA và trộn đều. Lúc này ống đã sẵn sang cho phân tích.

3. Phân tích kháng thể kháng tiểu cầu trên máy flow cytometry

– Đưa các ống flow cytometry đã chuẩn bị ở trên (ống 1, 2…5, 6,7) vào vị trí đọc trên máy.

– Mở chương trình phân tích kháng thể kháng tiểu cầu đã lập săn trên máy. Nhập vị trí ống phân tích và chạy chương trình phần mềm phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

– Quan sát trên quần thể tiểu cầu (quần thể dương tính với CD61).

– Dùng các ống nhuộm anti mouse IgG làm chuẩn ngưỡng âm tính cho từng kênh màu và từng nghiệm ống mẫu xét nghiệm (ống 1 và 4 để lấy chuẩn kênh mầu FITC và PE, ống 2 làm ngưỡng âm cho ống 3, ống 5 làm ngưỡng âm cho ống 6, ống 7 làm ngưỡng âm cho ống 8).

– Nếu ống 3 có > 10% quần thể tiểu cầu khảo sát dương tính với anti human IgG: Kháng thể kháng tiểu cầu trực tiếp dương tính (có kháng thể trên bề mặt tiểu cầu người bệnh).

– Nếu ống 6 có > 10% quần thể tiểu cầu khảo sát dương tính với anti human IgG: Hệ thống xét nghiệm tốt, chứng dương còn hoạt động.

– Nếu ống 8 có > 10% quần thể tiểu cầu khảo sát dương tính với anti human IgG: Kháng thể kháng tiểu cầu gián tiếp dương tính (có kháng thể kháng tiểu cầu tự do trong huyết thanh người bệnh).

Bình thường: Tất cả các ống đều âm tính với anti human IgG.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy xét nghiệm và trên ống mẫu không thống nhất, mẫu ống citrate natri bị đông, mẫu không ghi giờ lấy.

Xử trí: yêu cầu nơi đưa mẫu xác minh lại thong tin cần thiết, nếu mẫu bị đông phải lấy lại mẫu bệnh phẩm.

– Không thấy quần thể dương tính với CD61 trên flow cytometry. Nguyên nhân có thể do kháng thể anti CD61 kém chất lượng; kỹ thuật ly tâm tách tiểu cầu làm chưa đúng; kỹ thuật rửa tiểu cầu không đúng.

Xử trí: làm lại xét nghiệm và tuân thủ đúng quy trình.

– Không thấy có quần thể tế bào khi chạy flow cytometry: có thể do máy không đủ áp lực; tắc kim hút, có bọt khí trong đường dẫn dịch.

Xử trí: Kiểm tra lại máy, nếu cần phải rửa máy, đuổi bọt khí và thong kim hút theo hướng dẫn đi theo máy.

TÀI LIỆU THAM KHẢO

1. Carolina Bonet Bub, Beatriz Moraes Martinelli, et al. Platelet antibody detection by flow cytometry: an effective method to evaluate and give transfusional support in platelet refractoriness. Rev Bras Hematol Hemoter. 2013; 35(4): 252-255.

2. Beckman Coulter. 2011. Anti human CD61-PE Used manual

3. Beckman Coulter. 2010. Anti human IgG-FITC Used manual

4. Beckman Coulter. 2011. Goat Anti Mouse IgG1-FITC Used manual

PHÂN TÍCH DẤU ẤN/CD/MARKER MIỄN DỊCH MÁU NGOẠI VI, HOẶC DỊCH KHÁC BẰNG KỸ THUẬT FLOW CYTOMETRY (LÀM CHO 1 DẤU ẤN/CD/MARKER)

(Blood or other fluid Immunophenotyping by flow cytometry)

I. NGUYÊN LÝ

– Cùng với sự phát triển của tế bào tạo máu, các quần thể tế bào máu thuộc từng dòng khác nhau và các lứa tuổi khác nhau mang những đặc điểm dấu ấn miễn dịch (còn gọi là các marker hay các CD) khác nhau. Ví dụ CD45 là kháng nguyên bạch cầu chung, có trên bề mặt tất cả các tế bào bạch cầu trưởng thành. Ở giai đoạn non, bạch cầu có thể dương tính yếu hoặc âm tính với CD45. Các dấu ấn miễn dịch non khác như CD34, HLA-DR, TdT gặp ở những tế bào non. Các dấu ấn đặc trưng cho dòng tủy chung có CD13, CD33, CD15, CD117, MPO…; cho dòng mono có thêm CD14, CD16; cho dòng hồng cầu có thêm CD123a, CD71; cho dòng tiểu cầu có thêm CD41, CD61. Các dấu ấn miễn dịch đặc trưng cho dòng lympho B có CD10, CD19, CD20, CD22…; cho dòng lympho T có CD2, CD3, CD5, CD7, CD4, CD3, CD8….

– Trên phân tích tế bào dòng chảy, tế bào máu ngoại vi ủ với anti CD45 sau ly giải hồng cầu sẽ phân bổ trên đồ thị SS vs CD45 thành 3 vùng quần thể rõ rệt: vùng bạch cầu hạt, vùng mono, và vùng lympho.

– Các quần thể tế bào blast ác tính thường xuất hiện trong vùng cửa sổ blast (trên đồ thị SS vs CD45), và/hoặc có các đặc điểm không đồng bộ về kháng nguyên (xuất hiện đồng thời các kháng nguyên thuộc đặc trưng các dòng tế bào khác nhau, xuất hiện đồng thời các kháng nguyên thuộc các giai đoạn phát triển khác nhau của cùng 1 dòng tế bào), xuất hiện kháng nguyên quá mức, giảm hoặc mất biểu hiện một kháng nguyên nào đó. Trong quá trình biệt hóa, các tế bào máu có sự xuất hiện hoặc là mất đi các dấu ấn miễn dịch. Mỗi một dòng tế bào, một giai đoạn tế bào sẽ có những dấu ấn miễn dịch đặc trưng. Vì vậy, có thể căn cứ vào sự có mặt hoặc không có mặt các dấu ấn miễn dịch có thể xác định được dòng tế bào và giai đoạn biệt hóa của tế bào ung thư trong Lơ xê mi cấp.

– Bằng cách sử dụng các kháng thể đơn dòng chống lại các dấu ấn miễn dịch đặc hiệu và phân tích trên máy Flow cytometry có thể phân tích được kiểu hình miễn dịch của một loại tế bào nào đó, xác định được tế bào ung thư máu thuộc dòng nào và giai đoạn biệt hóa nào.

II. CHỈ ĐỊNH

– Lơ xê mi cấp (nếu không lấy được tủy xương).

– Lơ xê mi kinh (nếu không lấy được tủy xương).

– Đa u tủy xương (nếu không lấy được tủy xương).

– Rối loạn sinh tủy (nếu không lấy được tủy xương).

– Rối loạn tăng sinh dòng lympho.

– Suy giảm miễn dịch bẩm sinh.

– Suy giảm miễn dịch thứ phát (sau nhiễm HIV, sau điều trị hóa chất, sau nhiễm trùng nặng…).

– Nghi ngờ khối u thâm nhiễm thần kinh trung ương, khoang màng phổi, khoang màng bụng…

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên và cử nhân đã được đào tạo: thực hiện kỹ thuật.

– Bác sỹ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện, hóa chất

2.1. Phương tiện

– Máy phân tích tế bào dòng chảy (máy flow cytometer);

– Máy ly tâm;

– Máy lắc trộn;

– Pipet man và đầu pipet loại 250 µl và 1.000 µl;

– Ống nghiệm flow cytometry (chuyên dụng cho máy phân tích tế bào dòng chảy).

2.2. Hóa chất chính

– Anti CD45-PC5 (có thể sử dụng màu huỳnh quang khác như PerPC5.5, APC, ECD…).

– kháng thể kháng 1 CD định khảo sát có gắn mầu huỳnh quang khác với màu huỳnh quang của kháng thể anti CD45 (ví dụ CD33-PE).

– Dung dịch ly giải hồng cầu.

– Dung dịch sheath chạy máy flow.

– Dung dịch đệm PBS.

2.3. Hóa chất, vật tư khác

Nước cất, hoá chất khử trùng Natri hypoclorite, găng tay.

3. Bệnh phẩm

– Là mẫu máu ngoại vi chống đông bằng EDTA hoặc mẫu dịch chọc hút (màng phổi, màng bụng, dịch khớp…). Mẫu được lấy từ các người bệnh nghi ngờ lơ xê mi cấp hoặc các bệnh lý huyết học lành tính và ác tính khác. Tuy nhiên trong một số trường hợp nhất định có thể lấy mẫu từ các người bệnh có tình trạng bệnh lý khác (nhiễm trùng, nhiễm HIV, suy giảm miễn dịch…) tùy thuộc vào mục đích khảo sát của bác sỹ lâm sàng.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

– 2ml máu ngoại vi chống đông bằng EDTA.

– Mẫu cần được ủ kháng thể ngay trong vòng 6 giờ sau lấy mẫu.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị mẫu

– Đếm số lượng bạch cầu có trong mẫu, điều chỉnh số lượng bạc cầu về 1 x 10º tế bào/ml.

– Lấy 100 µl máu đã điều chỉnh số lượng tế bào cho vào 1 ống nghiệm flow cytometry.

– Ly giải hồng cầu bằng 1 ml dung dịch ly giải hồng cầu, ủ nhiệt độ phòng trong 10 phút.

– Ly tâm rửa huyền dịch tế bào sau ly giải hồng cầu 2 lần, mỗi lần làm như sau: thêm 3 ml dung dịch PBS vào ống flow cytometry, trộn lắc đều và ly tâm 2000 vòng/phút trong 3 phút. Đổ bỏ dịch nổi, để lại cặn tế bào và lượng dịch còn lại (khoảng 100 µl). Trộn đều cặn và lượng dịch còn lại.

2.2. Ủ kháng thể

– Cho kháng thể anti CD45-PC5, kháng thể kháng dấu ấn miễn dịch cần khảo sát(ví dụ CD33-PE) (mỗi loại 20 ul) vào ống flow cytometry chứa cặn tế bào đã phá hồng cầu ở bước trên. Trộn đều và ủ nhiệt độ phòng 20 phút, tránh ánh sáng.

– Rửa bỏ kháng thể thừa: sau ủ, thêm 3 ml dung dịch PBS vào ống flow cytometry, trộn đều và ly tâm 2.000 vòng/phút trong 3 phút. Đổ bỏ dịch nổi, để lại cặn tế bào.

– Thêm 1 ml PBS vào ống cặn tế bào, trộn đều. Lúc này ống đã sẵn sàng cho phân tích.

2.3. Phân tích trên máy flow cytometry

– Đưa ống flow cytometry vào vị trí đọc trên máy.

– Mở chương trình phân tích dấu ấn miễn dịch đa màu đã lập sẵn trên máy. Nhập vị trí ống phân tích và chạy chương trình phần mềm phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

– Quy ước: với mỗi một CD nếu tỷ lệ dương tính trên 20% thì được gọi là dương tính với CD đó.

– Khi phân tích chủ yếu tập trung phân tích quần thể tế bào blast(nếu có). Trong một số trường hợp cụ thể (không phải bệnh máu ác tính), cần phân tích thêm các quần thể bạch cầu hạt, lympho, mono.

– Nếu quần thể blast dương tính với các dấu ấn dòng tủy như CD13, CD33… thì chẩn đoán là ung thư dòng tủy. Nếu dương tính với CD2, CD3, CD7, CD4, CD8… thì chẩn đoán là ung thư dòng lympho T. Nếu dương tính với các dấu ấn dòng lympho B như CD19, CD20CD22, CD79a… thì chẩn đoán là ung thư dòng lympho B. Nếu chỉ dương tính với CD34 thì chẩn đoán là ung thư tế bào gốc tạo máu chưa phân thể.

– Nếu không phải mẫu của người bệnh ung thư máu, tùy theo ý định của bác sỹ điều trị sẽ phân tích tỷ lệ % hoặc số lượng tuyệt đối (số tế bào/microlit) tế bào có mang một đặc điểm miễn dịch nhất định.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy xét nghiệm và trên ống mẫu không thống nhất, mẫu bị đông, mẫu không ghi giờ lấy.

Xử trí: yêu cầu nơi đưa mẫu xác minh lại các thông tin cần thiết, nếu mẫu bị đông hoặc đã để quá lâu thì phải lấy lại mẫu bệnh phẩm.

– Các tế bào bạch cầu nằm không đúng vùng tế bào trong cửa sổ chương trình chạy (Phải căn cứ vào đồ thị SS và CD45, căn cứ vào sự phân bổ rõ rệt của các quần thể tế bào trên đồ thị này và căn cứ vào quần thể tế bào lympho bình thường để xác định mức độ chồng lấp màu. Ở một mẫu máu bình thường, quần thể tế bào phân định thành 3 vùng rõ rệt là vùng bạch cầu hạt, vùng lympho và vùng mono). Nguyên nhân có thể do thực hiện không đúng, lượng kháng thể ủ không đủ, thực hiện không đủ các bước của quy trình, ủ không đủ thời gian, hút pipet không tốt, tắc kim hút trên máy…

Xử trí: Làm lại xét nghiệm và tuân thủ theo đúng quy trình. Kiểm tra máy trước khi phân tích, phải rửa máy, đuổi bọt khí và thông kim hút (nếu cần) theo hướng dẫn đi theo máy.

TÀI LIỆU THAM KHẢO

1. Beckman Coulter. 2011. IOTest CD45-PC5 Used manual.

2. Beckman Coulter. 2011. IOTest CD3-PE Used manual.

3. Beckman Coulter. 2011. IOTest CD33-FITC Used manual.

4. Beckman Coulter. 2011. IOTest CD34-PE Used manual.

5. Beckman Coulter. 2011. IOTest CD10-FITC Used manual.

6. Beckman Coulter. 2011. IOTest CD117-PE Used manual.

7. J J M Van Dongen, L Lhermitte, S Bottcher, J Almeida, V H J van der Velden, J Flores-Montero et al. 2012. EuroFlow antibody panels for standardized n- dimensional flow cytometric immunophenotyping of normal, reactive and malignant leukocytes. Leukemia. 26, 1908-1975.

PHÂN TÍCH DẤU ẤN/CD/MARKER MIỄN DỊCH TỦY XƯƠNG BẰNG KỸ THUẬT FLOW CYTOMETRY (LÀM CHO 1 DẤU ẤN/CD/MARKER)

(Bone marrow or lympho node Immunophenotyping by flow cytometry)

I. NGUYÊN LÝ

– Cùng với sự phát triển của tế bào tạo máu, các quần thể tế bào máu thuộc từng dòng khác nhau và các lứa tuổi khác nhau mang những đặc điểm dấu ấn miễn dịch (còn gọi là các marker hay các CD) khác nhau. Ví dụ CD45 là kháng nguyên bạch cầu chung, có trên bề mặt tất cả các tế bào bạch cầu trưởng thành. Ở giai đoạn non, bạch cầu có thể dương tính yếu hoặc âm tính với CD45. Các dấu ấn miễn dịch non khác như CD34, HLA-DR, TdT gặp ở những tế bào non. Các dấu ấn đặc trưng cho dòng tủy chung có CD13, CD33, CD15, CD117, MPO…; cho dòng mono có thêm CD14, CD16; cho dòng hồng cầu có thêm CD123a, CD71; cho dòng tiểu cầu có thêm CD41, CD61. Các dấu ấn miễn dịch đặc trưng cho dòng lympho B có CD10, CD19, CD20, CD22…; cho dòng lympho T có CD2, CD3, CD5, CD7, CD4, CD3, CD8….

– Trên phân tích tế bào dòng chảy, tế bào tủy ủ với anti CD45 sau ly giải hồng cầu sẽ phân bổ trên đồ thị SS vs CD45 thành 3 vùng quần thể rõ rệt: vùng bạch cầu hạt, vùng mono, và vùng lympho.

– Các quần thể tế bào blast ác tính thường xuất hiện trong vùng cửa sổ blast (trên đồ thị SS vs CD45), và/hoặc có các đặc điểm không đồng bộ về kháng nguyên (xuất hiện đồng thời các kháng nguyên thuộc đặc trưng các dòng tế bào khác nhau, xuất hiện đồng thời các kháng nguyên thuộc các giai đoạn phát triển khác nhau của cùng 1 dòng tế bào), xuất hiện kháng nguyên quá mức, giảm hoặc mất biểu hiện một kháng nguyên nào đó. Trong quá trình biệt hóa, các tế bào máu có sự xuất hiện hoặc là mất đi các dấu ấn miễn dịch. Mỗi một dòng tế bào, một giai đoạn tế bào sẽ có những dấu ấn miễn dịch đặc trưng. Vì vậy, có thể căn cứ vào sự có mặt hoặc không có mặt các dấu ấn miễn dịch có thể xác định được dòng tế bào và giai đoạn biệt hóa của tế bào ung thư trong Lơ xê mi cấp.

– Bằng cách sử dụng các kháng thể đơn dòng chống lại các dấu ấn miễn dịch đặc hiệu và phân tích trên máy Flow cytometry có thể phân tích được kiểu hình miễn dịch của một loại tế bào nào đó, xác định được tế bào ung thư máu thuộc dòng nào và giai đoạn biệt hóa nào.

II. CHỈ ĐỊNH

– Lơ xê mi cấp;

– Lơ xê mi kinh;

– Đa u tủy xương;

– Rối loạn sinh tủy;

– Rối loạn tăng sinh dòng lympho;

– U lympho không Hodgkin;

– U lympho Hodgkin.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên và cử nhân đã được đào tạo: thực hiện kỹ thuật.

– Bác sỹ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện, hóa chất

2.1. Phương tiện

– Máy phân tích tế bào dòng chảy (máy flow cytometer).

– Máy ly tâm.

– Máy lắc trộn.

– Pipet man và đầu pipet loại 250 µl và 1.000 µl.

– Ống nghiệm flow cytometry (chuyên dụng cho máy phân tích tế bào dòng chảy).

2.2. Hóa chất chính

– Anti CD45-PC5 (có thể sử dụng màu huỳnh quang khác như PerPC5.5, APC, ECD…).

– Kháng thể kháng 1 CD định khảo sát có gắn mầu huỳnh quang khác với màu huỳnh quang của kháng thể anti CD45 (ví dụ CD33-PE).

– Dung dịch ly giải hồng cầu.

– Dung dịch sheath chạy máy flow.

– Dung dịch đệm PBS.

2.3 Hóa chất, vật tư khác

– Nước cất, hoá chất khử trùng Natri hypoclorite, găng tay.

3. Bệnh phẩm

Là mẫu dịch hút tủy xương chống đông bằng EDTA, hoặc mẫu nghiền từ hạch. Mẫu được lấy từ các người bệnh nghi ngờ lơ xê mi cấp, u lympho hoặc các bệnh lý huyết học lành tính và ác tính khác.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

– 1-2 ml dịch hút tủy xương chống đông bằng EDTA.

– Trường hợp là mẫu sinh thiết hạch, cần khoảng bằng ½ hạt gạo.

– Mẫu cần được gửi đến phòng xét nghiệm flow cytometry ngay trong vòng 6 giờ sau lấy mẫu.

2. Tiến hành kỹ thuật

2.1. Xử lý mẫu

– Nếu là mẫu hạch: nghiền mẫu với 2 ml dung dịch PBS bằng dụng cụ nghiền mẫu. Sau nghiền đem lọc huyền dịch tế bào qua lưới nylon mịn để loại bỏ tổ chức xơ sợi. Chỉnh huyền dịch tế bào sau lọc về nồng độ khoảng 1 x 10^6 tế bào/ml.

– Nếu là mẫu dịch hút tủy xương: Lọc dịch hút tủy xương qua lưới nylon mịn để loại bỏ tổ chức xơ sợi, mỡ, và các mảnh vụn xương (nếu có). Chỉnh huyền dịch tế bào sau lọc về nồng độ khoảng 1 x 10^6 tế bào bạc cầu/ml.

2.2. Chuẩn bị mẫu

– Lấy 100 µl mẫu đã chuẩn bị cho vào 1 ống nghiệm flow cytometry.

– Ly giải hồng cầu bằng 1 ml dung dịch ly giải hồng cầu, ủ nhiệt độ phòng trong 10 phút (với mẫu hạch không cần làm bước ly giải mà chuyển thẳng tới bước ủ kháng thể.

– Ly tâm rửa huyền dịch tế bào sau ly giải hồng cầu 2 lần, mỗi lần làm như sau: thêm 3 ml dung dịch PBS vào ống flow cytometry, trộn lắc đều và ly tâm 2000 vòng/phút trong 3 phút. Đổ bỏ dịch nổi, để lại cặn tế bào và lượng dịch còn lại (khoảng 100 µl). Trộn đều cặn và lượng dịch còn lại.

2.3. Ủ kháng thể

– Cho kháng thể anti CD45-PC5, kháng thể kháng dấu ấn miễn dịch cần khảo sát (ví dụ CD33-PE) (mỗi loại 20 ul) vào ống flow cytometry chứa cặn tế bào đã phá hồng cầu ở bước trên. Trộn đều và ủ nhiệt độ phòng 20 phút, tránh ánh sáng.

– Rửa bỏ kháng thể thừa: sau ủ, thêm 3 ml dung dịch PBS vào ống flow cytometry, trộn đều và ly tâm 2.000 vòng/phút trong 3 phút. Đồ bỏ dịch nổi, để lại cặn tế bào.

– Thêm 1 ml PBS vào ống cặn tế bào, trộn đều. Lúc này ống đã sẵn sàng cho phân tích.

2.4. Phân tích trên máy flow cytometry

– Đưa ống flow cytometry vào vị trí đọc trên máy.

– Mở chương trình phân tích dấu ấn miễn dịch đa màu đã lập sẵn trên máy. Nhập vị trí ống phân tích và chạy chương trình phần mềm phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

– Quy ước: với mỗi một CD nếu tỷ lệ dương tính trên 20% thì được gọi là dương tính với CD đó.

– Khi phân tích chủ yếu tập trung phân tích quần thể tế bào blast(nếu có). Trong một số trường hợp cụ thể (không phải bệnh máu ác tính), cần phân tích thêm các quần thể bạch cầu hạt, lympho, mono.

– Nếu quần thể blast dương tính với các dấu ấn dòng tủy như CD13, CD33… thì chẩn đoán là ung thư dòng tủy. Nếu dương tính với CD2, CD3, CD7, CD4, CD8… thì chẩn đoán là ung thư dòng lympho T. Nếu dương tính với các dấu ấn dòng lympho B như CD19, CD20, CD22, CD79a… thì chẩn đoán là ung thư dòng lympho B. Nếu chỉ dương tính với CD34 thì chẩn đoán là ung thư tế bào gốc tạo máu chưa phân thể.

– Nếu không phải mẫu của người bệnh ung thư máu, tùy theo ý định của bác sỹ điều trị sẽ phân tích tỷ lệ % hoặc số lượng tuyệt đối (số tế bào/microlit) tế bào có mang một đặc điểm miễn dịch nhất định.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy xét nghiệm và trên ống mẫu không thống nhất, mẫu bị đông, mẫu không ghi giờ lấy.

Xử trí: yêu cầu nơi đưa mẫu xác minh lại các thông tin cần thiết, nếu mẫu bị đông hoặc đã để quá lâu thì phải lấy lại mẫu bệnh phẩm.

– Các tế bào bạch cầu nằm không đúng vùng tế bào trong cửa sổ chương trình chạy (Phải căn cứ vào đồ thị SS và CD45, căn cứ vào sự phân bổ rõ rệt của các quần thể tế bào trên đồ thị này và căn cứ vào quần thể tế bào lympho bình thường để xác định mức độ chồng lấp màu. Ở một mẫu máu bình thường, quần thể tế bào phân định thành 3 vùng rõ rệt là vùng bạch cầu hạt, vùng lympho và vùng mono). Nguyên nhân có thể do thực hiện không đúng, lượng kháng thể ủ không đủ, thực hiện không đủ các bước của quy trình, ủ không đủ thời gian, hút pipet không tốt, tắc kim hút trên máy…

Xử trí: Làm lại xét nghiệm và tuân thủ theo đúng quy trình. Kiểm tra máy trước khi phân tích, phải rửa máy, đuổi bọt khí và thông kim hút (nếu cần) theo hướng dẫn đi theo máy.

TÀI LIỆU THAM KHẢO

1. Beckman Coulter. 2011. IOTest CD45-PC5 Used manual.

2. Beckman Coulter. 2011. IOTest CD3-PE Used manual.

3. Beckman Coulter. 2011. IOTest CD33-FITC Used manual.

4. Beckman Coulter. 2011. IOTest CD34-PE Used manual.

5. Beckman Coulter. 2011. IOTest CD10-FITC Used manual.

6. Beckman Coulter. 2011. IOTest CD117-PE Used manual.

7. JJ M Van Dongen, L Lhermitte, S Bottcher, J Almeida, V H J van der Velden, J Flores-Montero et al. 2012. EuroFlow antibody panels for standardized n- dimensional flow cytometric immunophenotyping of normal, reactive and malignant leukocytes. Leukemia. 26, 1908-1975.

KHÁNG THỂ KHÁNG DENGUE IgG VÀ IgM (PHƯƠNG PHÁP THẤM MIỄN DỊCH)

(Anti Dengue IgG + IgM test by immunoblot)

I. NGUYÊN LÝ

Thuật ngữ Dengue chỉ virus sốt xuất huyết (virus Dengue) truyền qua muỗi Aedes aegyptiAedes albopictus lưu hành rộng rãi trong các vùng nhiệt đới và cận nhiệt đới của thế giới. Có 4 chủng được biết đến là Dengue 1, 2, 3 và 4. Người bị nhiễm virus Dengue có biểu hiện sốt cao, đau đầu, đau cơ, ban da, gây xuất huyết và ảnh hưởng đến hệ tuần hoàn máu.

Xét nghiệm nhanh SD BIOLINE Dengue IgG/IgM là thử nghiệm sắc ký miễn dịch dùng để phát hiện định tính và phân biệt nhanh kháng thể IgG và IgM kháng virus Dengue trong huyết thanh người.

Khi mẫu xét nghiệm được nhỏ vào giếng mẫu, các kháng thể IgG và IgM kháng Dengue trong mẫu thử sẽ phản ứng cộng hợp vàng – protein vỏ virus Dengue tái tổ hợp và hình thành phức hợp kháng nguyên – kháng thể. Phức hợp này di chuyển dọc theo chiều dài của dụng cụ xét nghiệm theo cơ chế mao dẫn và sẽ gắn với kháng thể IgG hoặc IgM người tương ứng tại 2 vạch thử trên dụng cụ xét nghiệm và tạo ra vạch màu. Nếu kháng thể IgG và/ hoặc IgM kháng virus Dengue không có trong mẫu thử thì không xuất hiện vạch màu tại “G” và “M”.

II. CHỈ ĐỊNH

Nghi ngờ sốt xuất huyết do virus Dengue.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên và cử nhân đã được đào tạo: thực hiện kỹ thuật.

– Bác sỹ xét nghiệm: đọc kết quả, đánh giá, kiểm tra chất lượng.

2. Phương tiện – Hóa chất

2.1 Phương tiện

– Máy ly tâm ống máu;

– Pipet và tip 100 ul

– Dụng cụ xét nghiệm SD BIOLINE Dengue IgG/IgM;

– Dung môi thử nghiệm: Đệm phosphate 100 mM (5ml), Natri azit (0.01%); Pipet mao dẫn 5 ul;

– Ngoài ra còn cần: găng tay, khẩu trang.

2.2. Hóa chất chính:

– Kít xét nghiệm SD BIOLINE Dengue IgG/IgM được hàn kín trong gói nhôm kèm gói hút ẩm. Một thanh xét nghiệm gồm:

+ Cộng hợp vàng (thành phần chính): protein vỏ của virus Dengue tái tổ hợp gắn vàng (1 ± 0.2 ug).

+ Vạch thử “G” (thành phần chính): kháng thể đơn dòng chuột kháng IgG người (5 ± 1 ug). + Vạch thử “M” (thành phần chính): kháng thể đơn dòng chuột kháng IgM người (5 ± 1 ug).

+ Vạch chứng (thành phần chính): IgG từ thỏ kháng Dengue (2.5 ± 0.5 ug).

– Dung môi thử nghiệm: Đệm phosphate 100 mM (5ml), Natri azit (0.01%)

2.3 Hóa chất, vật tư khác

– Nước cất, hoá chất khử trùng Natri hypoclorite, găng tay.

3. Mẫu bệnh phẩm

– Mẫu dùng là huyết thanh.

– Cần tách huyết thanh càng sớm càng tốt để tránh hiện tượng tan máu làm ảnh hưởng đến kết quả phản ứng.

– Nếu có lẫn hồng cầu hoặc những thành phần hữu hình trong mẫu huyết thanh thì cần ly tâm mẫu để loại bỏ các thành phần đó trước khi xét nghiệm.

– Mẫu huyết thanh bảo quản ở nhiệt độ 2°C đến 8°C có thể dùng làm xét nghiệm trong vòng 7 ngày. Nếu muốn để lâu hơn mới xét nghiệm cần phải bảo quản ở tủ lạnh sâu (≤ -20°C). Tuy nhiên với mẫu bảo quản lạnh sâu cần tránh đông-tan nhiều lần.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị mẫu và thanh xét nghiệm

– Chuẩn bị mẫu

+ Mẫu sử dụng là huyết thanh.

+ Lấy 3 ml máu toàn phần vào tube đựng (không chứa chất chống đông như Heparin, EDTA, và Natri citrate).

+ Ly tâm để thu lấy huyết thanh.

– Chuẩn bị thanh xét nghiệm: Lấy thanh xét nghiệm ra khỏi túi đựng và đặt lên mặt khô, phẳng, để nhiệt độ thanh xét nghiệm về cân bằng nhiệt độ phòng.

2. Nhỏ mẫu: Dùng pipet mao dẫn được cung cấp, nhỏ 5 ul huyết thanh vào giếng mẫu thử ký hiệu “S”.

3. Nhỏ dung môi thử nghiệm: Nhỏ 3 – 4 giọt dung môi thử nghiệm vào giếng dung môi hình tròn.

4. Ủ thanh xét nghiệm: ủ trong 20 phút, nhiệt độ phòng.

5. Đọc kết quả.

6. Phân tích kết quả.

VI. NHẬN ĐỊNH KẾT QUẢ

Căn cứ vào các vạch màu hồng xuất hiện trên thanh xét nghiệm, kết quả được đánh giá như sau:

– Âm tính (không nhiễm sốt xuất huyết): một vạch hồng “C” trong cửa sổ kết quả, bên phải.

– Dương tính:

+ IgM dương tính (nhiễm sốt xuất huyết tiên phát): hai vạch hồng “C” và “M” ở cửa sổ kết quả. Kết quả dương tính thậm chí nếu vạch “M” mờ.

+ IgG dương tính (nhiễm sốt xuất huyết thứ phát hoặc từng bị nhiễm) : hai vạch hồng “C” và “G” ở cửa sổ kết quả. Kết quả dương tính thậm chí nếu vạch “G” mờ.

+ IgM và IgG dương tính (nhiễm sốt xuất huyết tiên phát muộn hoặc thứ phát sớm): ba vạch hồng “C”, “M”, và “G” ở cửa sổ kết quả.

– Không giá trị

+ Không có vạch chứng “C” ở cửa sổ kết quả.

+ Nên thử lại mẫu.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Sai sót mẫu bệnh phẩm: tên người bệnh trên giấy chỉ định xét nghiệm và trên ống máu không thống nhất, máu bị đông. Các mẫu tan huyết, mẫu huyết thnah đục (làm sai lệch kết quả).

Xử trí: yêu cầu nơi đưa mẫu xác minh lại thông tin trên giấy chỉ định và trên ống máu, nếu cần phải lấy lại mẫu bệnh phẩm.

– Sử dụng pipet mao quản chung cho từng mẫu dẫn tới nhiễm chéo giữa các mẫu.

Xử trí: mỗi mẫu dùng một pipet mao quản, dùng xong bỏ đi không tái sử dụng.

– Mẫu hết hạn, mẫu không lên vạch chứng, thời gian ủ các bước quá lâu hoặc không đủ thời gian.

Xử trí: thực hiện lại xét nghiệm, kiểm tra chỉ dùng hóa chất còn hạn sử dụng và được bảo quản đúng điều kiện theo hướng đẫn của nhà sản xuất, tuân thủ đúng các bước quy trình, kiểm soát tốt nhiệt độ phòng xét nghiệm (25-30°C).

TÀI LIỆU THAM KHẢO

1. Sốt xuất huyết Dengue: Chuẩn đoán, điều trị, phòng bệnh và kiểm soát. Xuất bản lần thứ 2 của WHO 1997.

2. Hướng dẫn sử dụng xét nghiệm nhanh Dengue IgG/IgM. BIO LINE SD rapid test.

XÉT NGHIỆM XÁC ĐỊNH ĐỘT BIẾN THALASSEMIA (Phát hiện đồng thời 21 đột biến α-thalassemia hoặc 22 đột biến β-thalasemia)

THALASSEMIA MULTIPLE MUTATIONS DETECTION
(Simultaneously detects of 21 gene mutations of α-thalassemia or 22 gene mutations of β-thalassemia)

I. NGUYÊN LÝ

Xét nghiệm xác định đột biến thalassemia sử dụng bộ sinh phẩm α-globin và β- globin stripassay được phát triển dựa trên nguyên lý của kỹ thuật lai ADN ngược. Kỹ thuật sử dụng thanh teststrip có đính nhiều đầu dò để phát hiện đột biến và xác định tính đồng hợp/ dị hợp tử của đột biến. Bộ xét nghiệm α-globin stripAssay cho phép sàng lọc 21 đột biến α-thalassemia và bộ xét nghiệm β-globin stripAssay cho phép sàng lọc 22 đột biến β-thalasemia phổ biến trong khu vực Đông Nam Á.

II. CHỈ ĐỊNH

Chỉ định cho người bệnh thalassemia và các trường hợp nghi ngờ mang đột biến gen globin liên quan đến bệnh lý huyết sắc tố.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Nhân viên xét nghiệm sinh học phân tử đã được đào tạo.

2. Phương tiện – Hóa chất

2.1. Phương tiện

– Buồng vô trùng (Biology cabinet);

– Máy ly tâm tốc độ cao (tốc độ tối đa 14.000 vòng/phút);

– Máy vortex;

– Các loại pipet 10 µl, 20 µl, 100 μl, 200 µl, 1000 μι;

– Đầu côn có màng lọc;

– Ống eppendorf 1,5 ml vô trùng, không có enzym nuclease;

– Ống PCR 0,2 ml vô trùng, không có enzym nuclease;

– Tủ lạnh 4-8°C, tủ -20°C;

Găng tay.

2.2 Hóa chất:

– Sử dụng sinh phẩm tách ADN thương mại. Nếu tách thủ công thì sử dụng các sinh phẩm cần thiết để tách chiết ADN như dung dịch ly giải màng tế bào, dung dịch biến tính protein, các dung dịch rửa, cồn tuyệt đối.

– Bộ sinh phẩm α-Globin Stripassay và β-Globin Stripassay.

3. Bệnh phẩm

2 ml máu toàn phần đựng trong ống chống đông EDTA.

4. Phiếu xét nghiệm

Có đầy đủ các thông tin cần thiết về người bệnh như: tên, tuổi, nơi ở, chẩn đoán ban đầu, yêu cầu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

– 2 ml máu ngoại vi chống đông bằng EDTA, bảo quản mẫu trong -20°C nếu chưa thực hiện xét nghiệm.

2. Tiến hành kỹ thuật

Bước 1: Tách chiết ADN

Phương pháp tách chiết ADN cơ bản bao gồm các giai đoạn chính sau:

Phá màng tế bào và màng nhân:

– Tế bào được ủ trong một dung dịch gồm chất tẩy mạnh (như SDS, sarcosyl), chất gây biến tính protein (guanidinium thyocianat) và chất khử (2-mercaptoethanol). Mục đích của bước này là để phá màng tế bào và màng nhân đồng thời để ức chế hoạt động của các enzym RNase nội bào, biến tính protein để giải phóng các phân tử ADN ở trạng thái tự do.

Loại bỏ các protein:

Sử dụng dung dịch phenol: chloroform để biến tính protein, làm cho protein tạo thành một lớp tủa rõ rệt sau khi ly tâm, dễ dàng loại bỏ khỏi hỗn dịch.

Tủa ADN:

Sử dụng isopropanol hoặc ethanol với muối để tủa ADN trong điều kiện nhiệt độ âm sâu rồi thu nhận ADN bằng ly tâm. ADN được tái hòa tan trong nước tỉnh sạch đã khử enzym (free-nuclease).

Bước 2. Thực hiện phản ứng PCR

1. Giữ tất cả hóa chất và ADN khuôn trong khay giữ lạnh. Tiến hành tất cả các bước ở trên khay trữ lạnh (0-4°C) cho đến khi bắt đầu chạy máy.

2. Chuẩn bị dịch hỗn hợp gồm Taq ADN Polymerase và Taq Dilution Buffer.

3. Chuẩn bị thành phần cho phản ứng PCR theo bảng sau:

β-globin stripassay (1 pứ/mẫu) α-globin stripassay (3 pứ/mẫu)
15 µl Ampiification Mix

5 µl Taq ADN Polymerase (0,2 U/µl)

5 µl ADN khuôn

A1: 15 µl Ampiification Mix A1

5 µl Taq ADN Polymerase (0,33 U/µl)

5 µl ADN khuôn

A2: 15 µl Ampiification Mix A2

5 µl Taq ADN Polymerase (0,33 U/µl)

5 µl ADN khuôn

B: 15 µl Ampiification Mix B

5 µl Taq ADN Polymerase (0,33 U/µl)

5 µl ADN khuôn

94°C/2′ |94°C/15” – 58°C/30” – 72°C/45”|x35 72°C/3′ 95°C/5′ |97°C/40” – 64°C/40” – 72°C/1’30”|x3 |97°C/40” – 58°C/40” – 72°C/1’30”|x37

72°C/5′

 

Bước 3. Điện di kiểm tra ADN sản phẩm PCR

– Kiểm tra sản phẩm PCR bằng điện di trên gel 3% (không bắt buộc).

Bước 4. Qui trình lai ADN

Trước khi lai: khởi động bể ổn nhiệt và máy lắc ổn nhiệt tới 45°C (±0.5°C). Cho lọ Hybridization Buffer và Wash Solution A vào bể ổn nhiệt để làm ẩm trước khi sử dụng

4.1. Lai ADN với teststrip (45°C; máy lắc ổn nhiệt)

1. Kiểm tra nhiệt độ của bể ổn nhiệt và máy lắc. Đảm bảo đạt 45°C trước khi tiến hành.

2. Để tất cả teststrip, ADNT, Conjugate Solution, Wash Solution B và Color Developer ra nhiệt độ phòng.

3. Lấy máng lai và viết ký hiệu trên mỗi rãnh tương ứng với teststrip của mỗi người bệnh.

4. Sử dụng kẹp hoặc nhíp sạch lấy teststrip cho 1 mẫu bệnh phẩm (chỉ cầm teststrip khi đã đeo bao tay!). Ghi ký hiệu ở ngoài vạch đánh dấu của teststrip sử dụng bút chì (không sử dụng bút bi, bút đánh dấu…).

5. Trộn thành phần cho phản ứng lai theo bảng sau:

β-globin stripassay
  • Hút 10 µl ADNT vào góc của mỗi rãnh đã đánh dấu trong máng lai.
  • Thêm 10 µl sản phẩm PCR vào giọt ADNT tương ứng.
    Trộn đều bằng pipette. (Dung dịch sẽ duy trì màu xanh)

 

α-globin stripassay/teststrip A α-globin stripassay/teststrip B
• Hút 20 µl ADNT vào góc của mỗi rãnh đã đánh dấu trong máng lai.

• Thêm 10 µl sản phẩm PCR A1 vào giọt ADNT tương ứng.

• Thêm 10 µl sản phẩm PCR A2 vào cùng một giọt.

Trộn đều bằng pipette. (Dung dịch sẽ duy trì màu xanh).

• Hút 10 µl ADNT vào góc của mỗi rãnh đã đánh dấu trong máng lai.

• Thêm 10 µl sản phẩm PCR B vào giọt ADNT tương ứng.

Trộn đều bằng pipette. (Dung dịch sẽ duy trì màu xanh).

 

6. Để yên 5 phút ở nhiệt độ phòng.

7. Thêm 1 ml Hybridization Buffer (đã làm ấm tới 45°C) trong mỗi rãnh. Lắc máng lai nhẹ nhàng (màu xanh sẽ biến mất).

8. Chèn teststrip A hoặc teststrip B đã đánh dấu vào lần lượt các rãnh. Nhấn chìm hoàn toàn teststrip.

9. Ủ 30 phút ở 45°C trong máy lắc ổn nhiệt, Tốc độ 250 rpm, đậy nắp khi ủ

10. Kết thúc ủ, loại bỏ đệm lai bằng pipet.

4.2. Rửa teststrip (45°C; máy lắc ổn nhiệt)

1. Thêm 1 ml Wash Solution A (đã làm ấm tới 45°C). Rửa nhanh (10 giây). Loại bỏ dịch bằng pipet.

2. Thêm 1 ml Wash Solution A (45°C).

3. Ủ 15 phút ở 45°C trong bể ổn nhiệt. Loại bỏ dịch bằng pipet.

4. Thêm 1 ml Wash Solution A (45°C).

5. Ủ 15 phút ở 45°C trong bể ổn nhiệt. Loại bỏ dịch bằng pipet.

Sau bước này cài nhiệt độ và 25°C và mở nắp máy lắc.

4.3. Hiện màu (nhiệt độ phòng)

1. Thêm 1 ml Conjugate Solution.

2. Ủ 15 phút ở nhiệt độ phòng trên máy lắc. Loại bỏ dịch bằng pipet.

3. Thêm 1 ml Wash Solution B. Rửa nhanh (10 giây). Loại bỏ dịch bằng pipet.

4. Thêm 1 ml Wash Solution B.

5. Ủ 5 phút ở nhiệt độ phòng trên máy lắc. Loại bỏ dịch bằng pipet.

6. Thêm 1 ml Wash Solution B.

7. Ủ 5 phút ở nhiệt độ phòng trên máy lắc. Loại bỏ dịch bằng pipet.

8. Thêm 1 ml Color Developer.

9. Ủ 15 phút ở nhiệt độ phòng trong tối và trên máy lắc.

Chất nhuộm mầu tía sẽ xuất hiện trên phản ứng dương tính.

10. Rửa teststrip vài lần với nước khử ion.

11. Để teststrip khô trong tối trên giấy thấm.

Tránh để teststrip tiếp xúc với ánh sáng mạnh sau khi phát triển màu.

VI. NHẬN ĐỊNH KẾT QUẢ

– Kiểu gen của một mẫu xét nghiệm được xác định từ teststrip tương ứng, qua việc đối chiếu teststrip với thang đo.

– Kết quả chỉ được chấp nhận khi xuất hiện đủ 3 vạch: vạch Control trên cùng, vạch Control A và vạch Control B.

– Mẫu dị hợp tử khi xuất hiện đồng thời cả vạch đột biến và vạch kiểu dại

– Mẫu đồng hợp tử một đột biến khi xuất hiện vạch đột và không xuất hiện vạch kiểu dại.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

SAI SÓT XỬ TRÍ
Lấy mẫu không đủ hoặc sai chất chống đông. Hướng dẫn qui cách lấy mẫu rõ ràng.
Thao tác pipet không chính xác. Sử dụng pipet theo đúng thể tích qui định.
Tín hiệu phản ứng không rõ ràng. Bảo quản hóa chất đúng theo khuyến cáo của nhà sản xuất

Thực hiện đúng, đủ các bước trong qui trình xét nghiệm

 

TÀI LIỆU THAM KHẢO

1. Tài liệu hướng dẫn đi kèm bộ sinh phẩm α-Globin Stripassay và β-Globin Stripassay

QUY TRÌNH XÉT NGHIỆM GEN BẰNG KỸ THUẬT cIg FISH

(Cytoplasmic Immunoglobulin Staining and Fluorescence in situ hybridization)

I. NGUYÊN LÝ

Kỹ thuật cIg FISH là sự phối hợp 2 kỹ thuật là nhuộm bào tương của tế bào plasmo (tương bào) và kỹ thuật FISH.

Kỹ thuật nhuộm bào tương của tế bào plasmo được tiến hành theo nguyên lý: bào tương của tế bào plasmo biểu hiện rất nhiều kháng thể có chuỗi nhẹ kappa hoặc lambda. Sử dụng các kháng kháng thể đơn dòng (anti-kappa hoặc anti-lambda) đã được gắn huỳnh quang để nhuộm bào tương của tương bào sẽ giúp xác định dễ dàng các tế bào này thông qua kính hiển vi huỳnh quang với màng lọc phù hợp

Kỹ thuật FISH được tiến hành dựa trên cơ sở của phản ứng lai ghép. Trong tế bào, phân tử ADN tồn tại dưới dạng phân tử kép gồm 2 chuỗi đơn gắn kết bổ sung với nhau thông qua liên kết hydro. Liên kết hydro là liên kết yếu nên dễ dàng bị đứt gãy dưới tác động của nhiệt độ hay pH cao. Lúc đó, phân tử ADN bị tách thành 2 chuỗi đơn. Tuy nhiên khi nhiệt độ hay pH giảm, các chuỗi đơn lại ghép nhau theo nguyên tắc bổ sung.

Dựa trên đặc tính này, kỹ thuật FISH sử dụng các probe là đoạn ADN đặc hiệu có gắn huỳnh quang để lai ghép với các đoạn ADN tương đồng trên nhiễm sắc thể. Từ đó, chúng ta có thể phát hiện bất thường nhiễm sắc thể một cách chính xác và nhanh chóng.

Sử dụng kỹ thuật cIg FISH giúp đánh giá những tổn thương di truyền khu trú trên dòng tế bào plasmo ác tính nên tránh được âm tính giả.

II. CHỈ ĐỊNH

Chỉ định cho người bệnh đa u tủy xương, các bệnh lý liên quan đến tế bào lympho B.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Nhân viên xét nghiệm di truyền – sinh học phân tử đã được đào tạo.

2. Phương tiện, hóa chất

2.1. Phương tiện

– Thiết bị: bể ổn nhiệt, máy lai, máy ly tâm, máy trộn mẫu, và kính hiển vi huỳnh quang.

– Dụng cụ: kẹp kim loại, 10 cóng Coplin, nhiệt kế, coverslip 22×22, pipetman 100 µl, 10 µl, xi măng cao su, ống đong, giấy thấm.

2.2. Hóa chất

– Probe phù hợp tương ứng với đoạn gen cần phát hiện.

– Dung dịch 10% formamide: 5 ml formamide + 30 ml H2O + 15 ml 20X SSC.

– Dung dịch 2X SSC.

– Dung dịch rửa 0,1% NP40: 2X SSC +0,1% NP40.

– Dung dịch rửa 0,3% NP-40: 0,4X SSC + 0,3% NP40.

– Cồn 70°, 85°, 100°.

– Ficoll Paque.

– Dung dịch PBS 1X.

– Dung dịch SSC 20X.

– Dung dịch nhược trương: KCL 0,075M (PH=7,4). (5 ml/1 mẫu).

– Methanol tuyệt đối.

– Acid acetic.

– Mounting medium without DAPI.

– AMCA Goat Anti human lambda chain antibody.

– AMCA Goat Anti human kappa chain antibody.

– AMCA Rabbit Anti goat IgG antibody.

– LSI/WCP Hybridization Buffer.

3. Bệnh phẩm

2 ml dịch hút tủy xương của người bệnh đựng trong ống chống đông Sodium heparin.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị tiêu bản

Sau khi có dịch hút tủy xương của người bệnh, cần tiến hành kéo tiêu bản và phân tích tỷ lệ tương bào. Với những mẫu có tỷ lệ tương bào lớn hơn 10%, thực hiện các bước chuẩn bị tiêu bản như sau:

B1: Tách tế bào đơn nhân bằng ficoll:

– Cho toàn bộ dịch tủy của người bệnh vào ống falcon 15 ml. Cho thêm dung dịch PBS 1X đến 3,3 ml.

– Thêm 1ml ficoll vào (lưu ý cho đầu côn chứa ficoll xuống đáy ống falcon). Ly tâm 2100 vòng/phút trong 30 phút với chế độ “ no brake” cho máy ly tâm.

– Dùng pipet để bỏ phần huyền dịch phía trên chứa huyết tương và tiểu cầu. Sử dụng pipet khác để chuyển phần tế bào đơn nhân sang ống falcon khác.

– Rửa bằng cách cho thêm PBS vào phần tế bào đơn nhân theo tỷ lệ 3:1. Ly tâm 1400 vòng/phút trong 10 phút.

– Tái huyền dịch bằng PBS.

B2. Nhược trương tế bào:

– Xử lý tế bào đơn nhân bằng 5ml dung dịch KCl 0,075M trong 5 phút. Sau đó cho thêm 01 ml dung dịch Cornoy II (3 methanol: 1 acid acetic), trộn đều rồi đem ly tâm 1000 vòng/phút trong 10 phút.

– Loại bỏ dịch nổi.

B3. Cố định tiêu bản:

– Cho thêm 5ml dung dịch Cornoy II. Để ở nhiệt độ phòng trong 10 phút.

– Ly tâm 1000 vòng/phút trong 10 phút.

– Loại bỏ dịch nổi.

– Cho thêm 5 ml cồn 96°. Ly tâm 1000 vòng/phút trong 10 phút.

– Tái huyền dịch để có nồng độ tế bào phù hợp, nhỏ cặn tế bào lên lam kính.

2. Lai huỳnh quang tại chỗ

2.1. Xử lý tiêu bản

– Ngâm tiêu bản vào dung dịch 2X SSC ở 37±1°C trong 15 phút.

– Rửa tiêu bản qua cóng chứa dung dịch 2X SSC ở nhiệt độ phòng trong 5 phút.

– Chuyển tiêu bản qua cóng chứa dung dịch formaldehyde 10% ở nhiệt độ phòng trong 5 phút.

– Rửa tiêu bản qua cóng chứa dung dịch 2X SSC ở nhiệt độ phòng trong 5 phút.

– Chuyển tiêu bản qua cóng chứa cồn 70° trong 1 phút.

– Chuyển tiêu bản qua cóng chứa cồn 85° trong 1 phút.

– Chuyển tiêu bản qua cóng chứa cồn 100° trong 1 phút.

– Để tiêu bản khô hoàn toàn ở nhiệt độ phòng.

2.2. Chuẩn bị probe

– Trộn đều các dung dịch sau trong 1 ống PCR
(1 µl probe + 7 µl LSI + 2 µl dH2O) /1 tiêu bản

– Ly tâm nhẹ.

2.3.Lai

– Nhỏ 10 µl dung dịch probe vào khu vực đánh dấu trên tiêu bản sau đó che phủ bằng coverslip.

Yêu cầu: dung dịch probe thấm đều trên tiêu bản, không có bọt khí.

– Phủ kín coverslip bằng cao su xi măng.

– Đặt tiêu bản vào máy lai, chọn chương trình biến tính ở 73°C trong 3 phút và ủ 37°C trong 16 – 20 giờ.

2.4. Rửa sau khi lai

– Gỡ bỏ xi măng cao su và coverslip.

– Ngâm và lắc mạnh tiêu bản lần lượt qua các cóng Coplin sau:

+ Dung dịch (0,4X SSC/ 0,3% NP40): 2 phút, 73°C.

+ Dung dịch (2X SSC/0,1% NP40): 1phút, nhiệt độ phòng.

– Làm khô tiêu bản.

3. Nhuộm kháng thể tương bào

– Chuẩn bị 20 µl kháng kháng thể Kappa và Lambda/ tiêu bản (2 µl AMCA Anti- Human Kappa: 2 µl AMCA Anti-Human Lambda: 16 µl PBS 1X).

– Nhỏ 20 µl kháng kháng thể Kappa và Lambda lên bề mặt tiêu bản. Phủ kín tiêu bản bằng coverslip. Ủ trong tối ở 37°C tối thiểu 20 phút.

– Rửa qua 2 cóng chứa PBS 1X trong 2 phút mỗi cóng.

– Để tiêu bản khô hoàn toàn ở nhiệt độ phòng.

– Chuẩn bị 20 µl kháng kháng thể Ig (H+L)/ tiêu bản (1 µl AMCA Anti-Goat Ig (H+L): 19 µl PBS 1X).

– Nhỏ 20 µl kháng kháng thể Ig (H+L) lên bề mặt tiêu bản. Phủ kín tiêu bản bằng coverslip. Ủ trong tối ở 37°C tối thiểu 20 phút.

– Rửa qua 2 cóng chứa PBS 1X trong 2 phút mỗi cóng.

– Để tiêu bản khô hoàn toàn ở nhiệt độ phòng.

4. Phân tích kết quả

– Nhỏ 10-20 µl dung dịch antifade lên bề mặt tiêu bản để chống mất màu probe và ổn định tín hiệu DAPI trên tương bào.

– Phủ kín tiêu bản bằng coverslip.

Yêu cầu: dung dịch dàn đều trên tiêu bản và không có bọt khí.

– Quan sát dưới kính hiển vi huỳnh quang với màng lọc thích hợp.

– Quy tắc phân tích theo hướng dẫn cụ thể của nhà sản xuất cho từng loại probe.

Thông thường sẽ tiến hành phân tích 100 tương bào để đưa ra kết quả cuối cùng.

VI. NHỮNG SAI SÓT VÀ XỬ TRÍ

Vấn đề Nguyên nhân Cách khắc phục
Không có tín hiệu hoặc tín hiệu yếu Kính hiển vi không thích hợp hoặc có sự cố Kiểm tra lại kính và các vật kính
Probe không biến tính hoàn toàn Kiểm tra nhiệt độ bê âm có đúng (73+/-1)°C
Điều kiện lai không thích hợp Kiểm tra nhiệt độ tủ ẩm có đúng 37°C hay không.
Tăng thời gian lai lên 1 giờ
Điều kiện rửa không thích hợp Kiểm tra nhiệt độ bể ẩm có đúng 73°C
Kiểm tra các thành phần dung dịch rửa (pH…)
Xuất hiện bọt khí giữa tiêu bản và coverslip Loại bỏ bọt khí
Bảo quản probe không đúng cách Bảo quản probe ở -20°C, không ánh sang
Tín hiệu đặc trưng yếu Điều kiện lai không thích hợp Kiểm tra nhiệt đồ tủ ẩm có đúng 37°C
Nhiệt độ dung dịch rửa quá thấp Duy trì nhiệt độ dung dịch rửa ở (73+/-1)°C
Nền quá bẩn Tiêu bản làm già quá mức cho phép hoặc chứa nhiều tế bào chất Tăng thời gian biến tính của tiêu bản lên 10 phút
Tiêu bản không sạch hoặc nhiều mảnh vỡ tế bào trên tiêu bản Chuẩn bị lại tiêu bản
Các mảnh ADN không sạch Thực hiện lại bước rửa tiêu bản sau khi lai với formamide
Dung dịch rửa sai thành phần và nhiệt độ Kiểm tra lại dung dịch rửa
Hình thái các tế bào bị co cụm, biến dạng Để tiêu bản bị quá khô Tăng độ âm hoặc tăng nhiệt độ bê ấm trong quá trình tiến hành thí nghiệm
Tiêu bản chưa được sấy khô trước khi biến tính Chuẩn bị lại xét nghiệm với tiêu bản mới
Làm già tiêu bản trước khi tiến hành FISH 24 giờ
Tiêu bản chưa khô sau biến tính Sấy tiêu bản ở nhiệt độ 45°C trong 10-15 phút sau biến tính
Nhiệt độ bể ẩm quá cao Kiểm tra nhiệt độ bể ẩm có đúng (73+/-1)°C
Thời gian biến tính quá lâu Giảm thời gian biến tính 1 phút
Tín hiệu quá mạnh Nồng độ probe sử dụng quá cao so với dải màu của KHV Cố gắng chỉnh kính thay thế bằng các dải màu trung lập

 

TÀI LIỆU THAM KHẢO

1. Tài liệu hướng dẫn sử dụng của công ty Vysis.

2. Lynda J. Cambell (2011). “Detection of Chromosome Abnormalities using cytoplasmic Immunoglobulin staining and FISH in Myeloma“. Cancer Cytogenetics: Methods and Protocols, Human Press, p. 159-172.

3. Filkova H. Et al (2006). “Protocol for the identification of malignant plasma cells in bone marrow samples using simultaneous staining of cytoplasmic immunoglobulin with FISH (clg FISH)“. Detection of chromosomal aberrations in multiple myeloma. Masaryk University Press, p. 15-18.

XÉT NGHIỆM GIẢI TRÌNH TỰ GEN
TRÊN HỆ THỐNG MISEQ

(Gene sequencing on Illumina MiSeq system)

I. NGUYÊN LÝ

Kỹ thuật giải trình tự gen trên hệ thống MiSeq dựa trên nguyên lý tổng hợp chuỗi (synthesis-based) bổ sung với gen đích; trong đó mỗi loại nucleotit sử dụng trong phản ứng giải trình tự được đánh dấu với một chất huỳnh quang khác nhau và được phát hiện bằng hệ thống quang học. Từ đó cho phép xác định chính xác trình tự sắp xếp các nucleotit trên chuỗi ADN hoặc ARN.

II. CHỈ ĐỊNH

Chỉ định cho các người bệnh bị bệnh máu để phát hiện các đột biến gen gây bệnh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

Nhân viên xét nghiệm sinh học phân tử đã được đào tạo

2. Thiết bị – hoá chất

2.1. Thiết bị, vật tư tiêu hao:

– Pipet: 0,2-2µl, 1-10µl, 10-100µl, 20-200μl, 100-1000μl;

– Đầu côn RNAse-free, có màng lọc, loại 0,2-2µl, 1-10µl, 10-100µl, 20-200μl, 100-1000μl;

– Ống ly tâm 1,7ml RNAse-free và ống ly tâm không nắp 2ml;

– Ống PCR 0,2ml, RNAse-free;

– Ống real-time PCR 0,2ml, RNAse-free;

– Ống đo nồng độ ADN/ARN (Qubit);

– Ông falcon: 10ml, 50ml;

– Dao cắt gel;

– Giá từ;

– Máy ly tâm lạnh, để bàn;

– Máy lắc ủ nhiệt;

– Máy PCR;

– Máy lắc (vortex);

– Máy đo nồng độ ADN/ARN Nanodrop, Qubit 2.0;

– Hệ thống điện di và chụp ảnh gel;

– Hệ thống đọc trình tự gen MiSeq;

– Máy tính cấu hình cao (khuyến nghị: Core i7, 16-32Gb RAM, 1-2Gb VRAM đồ hoạ, ổ cứng SSD 1TB) và phần mềm phân tích kết quả.

2.2. và hoá chất:

– Agarose;

– Thuốc nhuộm gel;

– Loading dye;

– Gel marker;

– Đệm điện di TВЕ;

– H2O dùng cho sinh học phân tử, RNAse-free

– Cồn tuyệt đối ethanol và isopropanol dùng cho sinh học phân tử;

– Kit tách chiết ADN/ARN (QIAGene);

– Kit thôi gel (QIAGene);

– Kit tổng hợp cDNA (Invitrogen);

– Kit đo nồng độ ADN (Qubit)

– Kit chuẩn bị thư viện (Illumina Nextera XT);

– Kit định lượng thư viện (KAPA RQ-PCR library quatification);

– Kit chuẩn hoá thư viện (Sigma AMPure XP);

– Kit đọc trình tự gen (Illumina MiSeq reagent kit v2 300 cycles);

3. Mẫu xét nghiệm

2ml máu ngoại vi hoặc dịch tuỷ xương đựng trong ống chống đông với EDTA.

V. CÁC BƯỚC TIẾN HÀNH

1. Tách chiết vật liệu di truyền (ADN/ARN) từ mẫu máu ngoại vi hoặc dịch tuỷ xương (sử dụng kit QIAGene):

– Thu tế bào bạch cầu buffy coat, rửa và tái huyền dịch trong 200µl PBS 1X;

– Chuyển 200µl tế bào bạch cầu sang ống ly tâm 1,7ml;

– Thêm vào mỗi ống 400µl đệm RLT, trộn đều bằng bơm tiêm;

– Thêm vào mỗi ống 400µl ethanol 70%, trộn đều bằng đảo ngược ống;

– Chuyển toàn bộ dịch vào cột tách chiết, ly tâm 1 phút ở 10.000 vòng/phút, loại bỏ phần dịch ở đáy ống;

– Thêm vào mỗi cột 700µl dung dịch RW1, ly tâm 1 phút ở 10.000 vòng/phút, loại bỏ phần dịch ở đáy ống;

– Thêm vào mỗi cột 500µl dung dịch RPE, ly tâm 1 phút ở 10.000 vòng/phút, loại bỏ phần dịch ở đáy ống;

– Chuyển cột sang ống 2ml mới, ly tâm 1 phút ở 10.000 vòng/phút, loại bỏ phần dịch ở đáy ống;

– Chuyển cột sang ống ly tâm 1,7ml mới, thêm vào mỗi cột 50µl H2O, để ở nhiệt độ phòng 5 phút, ly tâm 1 phút ở 10.000 vòng/phút. Phần dịch thu được là RNA đã được tinh sạch;

– Đo nồng độ RNA bằng NanoDrop và bảo quản mẫu ở -80°C.

2. Thực hiện phản ứng phiên mã ngược (cDNA)

– Sử dụng 10pg-1µg RNA để thực hiện phản ứng cDNA với kit SuperScript VILO cDNA Synthesis kit;

– Chuẩn bị phản ứng theo bảng dưới đây:

Sinh phẩm T.phần/1 pứ
5X VILO Reaction Mix 4.0
10X SuperScript Enzyme

Mix

2.0
RNA (1µg)
H20 đến 20
Tổng thể tích 20

 

– Chu trình nhiệt cho phản ứng tổng hợp cDNA:

25°C 10′        42°C 60′     85°C 5′

– Sản phẩm cDNA được bảo quản ở -20°C.

3. Phân lập gen đích

Phân lập gen đích từ cDNA tổng số bằng PCR với bộ mồi phù hợp (tham khảo quy trình PCR chuẩn). Gen đích là đoạn hoặc các đoạn ADN cần phân tích, phục vụ chẩn đoán và điều trị cho mỗi loại bệnh khác nhau.

4. Tinh sạch gen đích bằng phương pháp thôi gel

– Điện di sản phẩm PCR (gen đích) trên gel agarose 1%, sử dụng marker phù hợp để định vị chính xác gen đích;

– Cắt khúc gel chứa băng sản phẩm cho vào ống ly tâm 1,7ml và xác định trọng lượng;

– Sử dụng kit QIAGene MinElute Gel Extraction kit để tỉnh sạch sản phẩm PCR. Tất cả các bước ly tâm đều thực hiện ở vòng quay ≥ 10.000g;

– Cho vào mỗi ống chứa sản phẩm PCR 3 lần thể tích đệm QG (mỗi 1mg gel được quy ước tương đương với 1 µl thể tích);

– Ủ ở 500C trong 10 phút để gel tan hoàn toàn;

– Thêm 1x thể tích cồn isopropanol (ví dụ: 100 µl cồn đối với 100mg gel) đảo nhẹ và chuyển toàn bộ dung dịch vào cột MinElute;

– Ly tâm cột MinElute 1 phút, loại bỏ dịch ở đáy ống;

– Cho vào mỗi cột 500 µl đệm QG, ly tâm 1 phút, loại bỏ dịch ở đáy ống;

– Cho vào mỗi cột 750 µl đệm PE, ly tâm 1 phút, loại bỏ dịch ở đáy ống;

– Chuyển cột sang ống ly tâm mới, ly tâm 1 phút, loại bỏ dịch ở đáy ống;

– Chuyển cột sang ống ly tâm 1,5ml, thêm vào mỗi cột 10 µl đệm EB (hoặc H2O), để ở nhiệt độ phòng 1 phút;

– Ly tâm cột 1 phút, thu dịch chứa ADN (gen) đích, đo nồng độ bằng NanoDrop, bảo quản ở -20°C.

5. Chuẩn bị thư viện DNA

5.1. Phân mảnh DNA thành các đoạn có chiều dài khoảng 300 bp

Chuẩn bị:

– Rã đông các ống ATM (Amplicon Tagment Mix), TD (Tagment DNA Buffer); và các mẫu DNA, giữ trong khay đá;

– Làm ấm ống NT (Neutralize Tagment Buffer) đến nhiệt độ phòng;

– Sau khi rã đông, nhẹ nhàng đảo ngược các ống hóa chất 3-5 lần để trộn đều.

Các bước thực hiện:

– Ký hiệu ống PCR mới là NTA;

– Cho 10 µl dung dịch đệm TD vào mỗi ống;

– Cho 5 µl hỗn hợp DNA của từng mẫu vào mỗi ống NTA riêng biệt;

– Thêm 5 µl ATM vào các ống, hút nhà pipet 5 lần;

– Đậy nắp các ống và ly tâm ở 280g, 20°C, trong 1 phút để đảm bảo các hóa chất được tập trung ở phần đáy ống;

– Đưa các ống NTA vào máy PCR, ủ ở nhiệt độ 55°C trong 5 phút, sau đó giữ ở 1°C;

– Thêm vào mỗi ống NTA 5 µl đệm, trộn đều bằng pipet 5 lần;

Đậy nắp và ly tâm ở 280g, 20°C, trong 1 phút;

Ủ các ống NTA ở nhiệt độ phòng trong 5 phút để bất hoạt hoàn toàn enzyme.

5.2. Gắn mã đánh dấu (barcode)

Chuẩn bị:

– Rã đông hóa chất NPM (Nextera PCR Master Mix) và các index ở nhiệt độ phòng trong khoảng 20 phút, nhẹ nhàng đảo ống 3-5 lần.

Các bước thực hiện:

– Đặt các ống NTA theo thứ tự cố định trên đĩa TruSeq Index Plate Fixture;

– Thêm 15 µl mastermix NPM vào từng ống NTA;

– Thêm vào mỗi ống NTA 5 µl index 1 và 5 µl index 2 theo tổ hợp để phân biệt các mẫu phân tích;

– Loại bỏ tất cả các nắp index đã dùng và thay bằng nắp mới (cung cấp theo kit);

– Đậy nắp các ống và ly tâm ở 280g, 20°C, trong 1 phút;

– Tiến hành phản ứng PCR để gắn index theo chương trình sau:

Nhiệt độ Thời gian Chu kỳ
72°C 3 phút 1 vòng
95°C 30 giây
95°C 10 giây 12 vòng
55°C 30 giây
72°C 30 giây
72°C 5 phút 1 vòng
4°C

Sơ đồ phối hợp mã đánh dấu (barcode):

Quyết định số 3336/QĐ-BYT ngày 20/07/2017 của Bộ Y tế về việc ban hành tài liệu Hướng dẫn quy trình kỹ thuật Huyết học - Truyền máu - Miễn dịch - Di truyền - Sinh học phân tử

A: Index N-7xx

B: Index S-5xx

C: Khay mẫu

5.3. Tinh sạch sản phẩm bằng hạt từ (AMPure XP)

Chuẩn bị:

– Đưa dung dịch chứa hạt từ AMPure XP về nhiệt độ phòng;

– Chuẩn bị cồn ethanol 80%.

Các bước thực hiện:

– Ly tâm ống NTA ở 280g trong 1 phút (20°C);

– Đánh dấu ống ly tâm 1,5, 1 mới là CAA;

– Chuyển 50 µl sản phẩm PCR từ ống NTA sang ống CAA;

– Trộn đều dung dịch AMPure XP trong 30 giây bằng vortex, thêm 90 µl AMPure XP vào từng ống CAA, trộn đều bằng pipet;

– Ủ ở nhiệt độ phòng trong 5 phút để DNA bám vào các hạt từ;

– Đặt ống trên giá từ trong 2 phút, để giữ hạt từ;

– Dùng pipet loại bỏ toàn bộ dịch trong ống;

– Giữ nguyên ống CAA trên giá từ, thêm 200 µl ethanol 80% vào các ống, ủ 30 giây, loại bỏ dung dịch bằng pipet (thực hiện bước này 2 lần);

– Giữ nguyên các ống CAA trên giá từ, để khô tự nhiên trong 15 phút;

– Nhấc các ống CAA khỏi giá từ, dùng pipet thêm 50 µl đệm RSB vào từng ống CAA, trộn đều bằng pipet;

– Ủ ở nhiệt độ phòng 2 phút. Sau đó đặt các ống lên giá từ trong 2 phút, dung pipet thu phần dung dịch (chứa DNA) đã tách ra khỏi hạt từ. Ký hiệu các ống mẫu là CAN;

– Đo nồng độ bằng Qubit 2.0;

– Bảo quản mẫu ở nhiệt độ -20°C.

5.4. Định lượng mẫu bằng RQ-PCR

Chuẩn bị:

– Pha loãng các mẫu sau khi tinh sạch theo tỷ lệ như sau:

+ Nồng độ DNA < 2 ng/µl: pha loãng 1.000 lần.

+ Nồng độ DNA từ 2 đến 10 ng/µl: pha loãng 5.000 lần.

+ Nồng độ DNA từ 10 đến 30 ng/µl: pha loãng 10.000 lần.

+ Nồng độ DNA >30 ng/µl: pha loãng 20.000 lần.

Chương trình chạy RQ-PCR:

– Công thức pha hỗn hợp phản ứng:

Thành phần phản ứng Thể tích/ hàm lượng
KAPA SYBR FAST qPCR Master mix 12 μι
DNA, standard (đã pha loãng) 4 μι
H₂O 4 μι
Tổng thể tích 20 μι

 

– Chu trình nhiệt:

Nhiệt độ Thời gian Chu kỳ
95°C 5 phút 1 vòng
95°C 30 giây 35 vòng

Đọc tín hiệu

60°C 45 giây
12°C

 

– Mỗi mẫu chạy lặp lại 3 lần để tính giá trị trung bình;

– Kết quả định lượng bằng RQ-PCR được tính toán với kết quả đo bằng Qubit để tính giá trị trung bình của mỗi mẫu, đây là giá trị nồng độ cuối cùng của các mẫu dùng để tính toán lượng mẫu đưa vào đọc trình tự.

5.5. Chuẩn hóa mẫu

Chuẩn bị:

– Rã đông ống LNA1 và làm ấm đến đến nhiệt độ phòng;

– Làm ấm ống LNB1 và LNW1 đến nhiệt độ phòng;

– Trộn đều ống LNB1 bằng vortex trong 1 phút;

– Làm ấm ống LNS1 về nhiệt độ phòng.

Các bước thực hiện:

– Đánh dấu một ống ly tâm 1,5ml sạch là LNP;

– Chuyển 20 µl dịch sản phẩm từ ống CAN ống LNP;

– Hút 1,1 ml LNA1 vào 1 ống ly tâm 1,5 ml.

– Trộn đều hạt từ trong ống LNB1 bằng pipet

– Hút 45 µl hỗn hợp LNA1/LNB1 vào mỗi ống LNP đã chứa sẵn mẫu;

– Lắc các ống LNP trên ở vận tốc 1.800 vòng/phút trong 30 phút;

– Đặt các ống trên giá từ trong 2 phút, loại bỏ dung dịch bằng pipet;

– Nhấc các ống LNP ra khỏi giá từ và tiến hành bước rửa với LNW1:

+ Thêm 45 µl LNW1 mỗi ống.

+ Đóng chặt nắp các ống.

+ Lắc với vận tốc 1.800 rpm trong 5 phút.

+ Đặt các ống trên gía từ trong 2 phút.

+ Cẩn thận loại bỏ dịch nổi, thay đầu côn sau mỗi lần thao tác.

– Lặp lại bước rửa một lần nữa với LNW1;

– Nhấc các ống LNP khỏi giá từ, thêm 30 µl NaOH 0,1 N vào các ống, lắc ống LNP tại vận tốc 1.800 vòng/phút, trong 5 phút;

– Trong khi lắc, chuẩn bị ống PCR, ký hiệu là SGP, và cho vào mỗi ống 30 µl dung dịch LNS1;

– Đặt các ống LNP trên giá từ trong 2 phút. Chuyển phần dung dịch chứa DNA sang ống SGP;

– Đo nồng độ bằng Qubit 2.0 và kit định lượng thư viện (KAPA library quantification).

– Bảo quản mẫu ở nhiệt độ -20°C.

6. Giải trình tự gen trên máy MiSeq

– Đối với bộ hoá chất đọc trình tự Reagent cartridge V2 300cycles, lượng mẫu đưa vào có nồng độ tối ưu là 12pMol;

– Pha loãng các mẫu và trộn tất cả các mẫu phân tích vào cùng 1 ống ly tâm và thêm dung dịch HT1 để đạt nồng độ cuối cùng là 12pMol.

Chuẩn bị mẫu

– Điều chỉnh block nhiệt cho ống 1,5 ml đến 96°C;

– Rã đông hóa chất MiSeq reagent, để ở nhiệt độ phòng;

– Chuẩn bị một hộp nước đá với tỷ lệ 3 đá – 1 nước;

– Làm ấm các ống SGP đến nhiệt độ phòng, trộn đều bằng pipet;

– Ký hiệu 1 ống ly tâm 1,5ml là ống PAL;

– Chuyển 10 µl của mỗi mẫu trong mỗi ống SGP vào ống PAL;

– Ký hiệu 1 ống ly tâm 1,5ml mới là ống DAL;

– Thêm 576 µl HT1 vào ống DAL;

– Chuyển 24 µl hỗn hợp DNA từ PAL vào ống DAL (có chứa HT1), trộn đều bằng pipet;

– Trộn ống DAL bằng vortex với tốc độ cao nhất;

– Đưa ống DAL vào block nhiệt ở 96°C, ủ trong 2 phút để đảm bảo các sợi DNA bị biến tính hoàn toàn;

– Đảo nghịch ống DAL 1-2 lần, đặt vào hộp nước đá, để trong vòng 5 phút;

– Đưa toàn bộ hỗn hợp trong ống DAL vào khay đọc trình tự (MiSeq reagent cartridge).

Các bước tiến hành đọc trình tự gen

– Khởi động máy trước khi chạy 15 phút;

– Khởi động chương trình Experiment manager để khai báo thông tin mẫu và thiết lập quy trình chạy;

– Khởi động chương trình MiSeq control;

– Nạp hoá chất và khay mẫu vào vị trí tương ứng trên máy;

– Kiểm tra xác nhận của máy, khai báo thông tin trên màn hình và tiến hành đọc trình tự.

Kết thúc đọc trình tự gen

– Kiểm tra bảng thông báo kết quả đọc trình tự gen;

– Tiến hành bước rửa thiết bị (post-run wash) theo hướng dẫn trên màn hình.

VI. PHÂN TÍCH KẾT QUẢ

1. Phân tích kết quả bước 1 (primary data analysis): là bước đối chiếu, xắp xếp các đoạn đọc trình tự ngắn, thu được từ quá trình giải trình tự, thành các trình tự dài hơn (contig) và cuối cùng là các trình tự hoàn chỉnh (gene hoặc genome). Bước này được thực hiện tự động với các chương trình, thuật toán cài đặt sẵn trong bộ công cụ phân tích hệ gen (GATK).

2. Phân tích kết quả bước 2 (secondary data analysis): là bước phân tích dữ liệu theo hướng quan tâm (như xác định đột biến, đa hình di truyền,…). Đối với hệ thống MiSeq, công cụ MiSeq reporter, cài đặt sẵn, phục vụ đầy đủ các mục đích cơ bản. Ngoài ra, có nhiều công cụ tin-sinh khác (CLC genomic workbench, Avadis,…) có thể được sử dụng để phân tích và khai thác dữ liệu ở mức độ sâu hơn.

VII. SAI SÓT VÀ XỬ TRÍ

Vấn đề Nguyên nhân Cách khắc phục
ADN không tỉnh sạch, lẫn ARN. Lượng tế bào bạch cầu quá nhiều so với cỡ cột tách;
Bước rửa không thực hiện tốt
Điều chỉnh lượng tế bào ban đầu theo mức phù hợp với cột; Tăng thêm 1 bước rửa.
Tổng hợp gen đích không thành công Mồi không đủ đặc hiệu;
Nồng độ các thành phần phản ứng không phù hợp;
Chưa tối ưu nhiệt độ.
Kiểm tra lại mồi, nồng độ các thành phần phản ứng và tiến hành chạy gradient nhiệt để tối
ưu nhiệt độ phản ứng
Kết quả đọc trình tự bị nhiễu Thư viện DNA không đạt đủ độ tinh sạch;
Biến tính chưa hoàn toàn;
Bước gắn barcode không thành công;
Lượng thư viện đưa vào quá nhiều;
Nhiễm chéo giữa các mẫu
Kiểm tra bước tinh sạch và chuẩn hoá thư viện;
Đảm bảo nhiệt độ và thời gian biến tính;
Kiểm tra bước gắn barcode theo quy trình chuẩn;
Kiểm soát lượng thư viện đưa vào đọc trình tự;
Đánh số và thay đầu côn sau khi thao tác với mỗi mẫu để loại bỏ nhiễm chéo.

TÀI LIỆU THAM KHẢO

1. Quy trình tách RNA từ dịch cơ thể (máu toàn phần, dịch tuỷ xương,…) của QIAGene: RNeasy_Mini_Handbook;

2. Quy trình PCR và RT-PCR của Invitrogen: Superscript onestep RT-PCR manual;

3. Quy trình tách chiết và tỉnh sạch sản phẩm PCR từ gel agarose của QIAGene: MinElute Handbook;

4. Quy trình đo nồng độ thư viện bằng Qubit: Qubit 2.0 Fluorometer manual;

5. Quy trình định lượng nồng độ thư viện bằng RQ-PCR của KAPA: KAPA Library Quantification for Illumina;

6. Quy trình chuẩn bị thư viện giải trình tự của Illumina: Illumina Nextera XT library preparation protocol;

7. Quy trình đọc trình tự gen trên hệ thống MiSeq: Illumina MiSeq operation manual.

8. Các tài liệu chuẩn khác về thao tác với mẫu dịch cơ thể, ADN/ARN, PCR, RT- PCR, real-time PCR, RQ-PCR, đo nồng độ ADN/ARN,…

9. Tài liệu hướng dẫn sử dụng phần mềm MiSeq reporter của Illumina: Illumina MiSeq reporter user manual.

10. Các tài liệu khác về phân tích dữ liệu tin-sinh học.

XÉT NGHIỆM GEN BẰNG KỸ THUẬT FISH VỚI TIÊU BẢN PARAFFIN

(Fluorescence in situ hybridization for paraffin-embedded tissue sections)

I. NGUYÊN LÝ

Kỹ thuật FISH được tiến hành dựa trên cơ sở của phản ứng lai ghép. Trong tế bào, phân tử ADN tồn tại dưới dạng phân tử kép gồm 2 chuỗi đơn gắn kết bổ sung với nhau thông qua liên kết hydro. Liên kết hydro là liên kết yếu nên dễ dàng bị đứt gãy dưới tác động của nhiệt độ hay pH cao. Lúc đó, phân tử ADN bị tách thành 2 chuỗi đơn. Tuy nhiên khi nhiệt độ hay pH giảm, các chuỗi đơn lại ghép nhau theo nguyên tắc bổ sung.

Dựa trên đặc tính này, kỹ thuật FISH sử dụng các probe là đoạn ADN đặc hiệu có gắn huỳnh quang để lai ghép với các đoạn ADN tương đồng trên nhiễm sắc thể. Từ đó, chúng ta có thể phát hiện bất thường nhiễm sắc thể một cách chính xác và nhanh chóng.

II. CHỈ ĐỊNH

Chỉ định cho các bệnh lý ác tính và thực hiện với các mô sinh thiết đúc paraffin.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Nhân viên xét nghiệm di truyền – sinh học phân tử đã được đào tạo.

2. Phương tiện, hóa chất

2.1. Phương tiện

– Thiết bị: bể ổn nhiệt, máy lai, máy ly tâm, máy trộn mẫu, và kính hiển vi huỳnh quang.

– Dụng cụ: kẹp kim loại, 10 cóng Coplin, nhiệt kế, coverslip 22×22, pipetman 100 µl, 10 µl, xi măng cao su, ống đong, giấy thấm.

2.2. Hóa chất

– Probe phù hợp tương ứng với đoạn gen cần phát hiện.

– DAPI (4,6-diamidino-2-phenylindol.2HCl)/ antifade.

– Dung dịch xử lý tiêu bản.

– Protease buffer.

– Dung dịch PBS (phosphate buffered saline).

– Xi măng cao su (rubber cement): Fixogum™.

– Dung dịch phân giải protein:

+ Dung dịch 2 X SSC.

+ Dung dịch rửa 2 X SSC, 0,05% Tween20, pH 7.0.

+ Cồn 100°.

+ Xylene

+ Dung dịch 0,4 X SSC.

2.3. Người bệnh

Các đối tượng người bệnh có chỉ định của lâm sàng.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị tiêu bản

– Cho tiêu bản paraffin vào tủ ấm 60°C tối thiểu 2 tiếng trước khi loại bỏ paraffin.

– Loại bỏ paraffin:

+ Làm nóng tiêu bản paraffin lên 60°C.

+ Chuyển tiêu bản paraffin ở 60°C vào cóng chứa xylene trong 10 phút.

+ Chuyển tiêu bản paraffin qua hai cóng chứa cồn 100°C, mỗi cóng trong 5 phút. Để khô tiêu bản parafin tự nhiên.

+ Chuyển tiêu bản paraffin vào cóng chứa dung dịch xử lý tiêu bản từ 10 đến 15 phút. (pH = 6.0, 96-98°C).

+ Rửa tiêu bản chứa paraffin qua cóng chứa dung dịch 2X SSC ở nhiệt độ phòng trong 5 phút.

+ Chuyển tiêu bản chứa paraffin qua cóng chứa dung dịch enzym phân giải protein (40ml protease buffer + 100µl protease).

+ Rửa tiêu bản chứa paraffin qua cóng chứa dung dịch 2X SSC ở nhiệt độ phòng trong 5 phút.

+ Chuyển tiêu bản paraffin qua cóng chứa cồn 100°C trong 2 phút.

+ Để khô tự nhiên.

2. Lai huỳnh quang tại chỗ

2.1. Chuẩn bị probe

– Trộn đều các dung dịch sau trong 1 ống PCR (1 µl probe + 7 µl LSI + 2 µl dH2O) /1 tiêu bản

– Ly tâm nhẹ.

2.2. Lai

– Nhỏ 10 µl dung dịch probe vào khu vực đánh dấu trên tiêu bản sau đó che phủ bằng coverslip.

Yêu cầu: dung dịch probe thấm đều trên tiêu bản, không có bọt khí.

– Phủ kín coverslip bằng cao su xi măng.

– Đặt tiêu bản vào máy lai, chọn chương trình biến tính ở 73°C trong 3 phút và ủ 37°C trong 16 – 20 giờ.

2.3. Rửa sau khi lai

– Gỡ bỏ xi măng cao su và coverslip.

– Ngâm và lắc mạnh tiêu bản lần lượt qua các cóng Coplin sau:

+ Dung dịch 0,4X SSC, pH 7.0: 2 phút, 73°C.

+ Dung dịch 2X SSC, Tween20 (pH7.0): 30 giây, nhiệt độ phòng.

– Rửa nhanh bằng nước cất.

– Làm khô tiêu bản.

VI. NHẬN ĐỊNH KẾT QUẢ

– Nhỏ 10-20 µl dung dịch antifade lên bề mặt tiêu bản để chống mất màu probe và ổn định tín hiệu DAPI trên tương bào.

– Phủ kín tiêu bản bằng coverslip.

Yêu cầu: dung dịch dàn đều trên tiêu bản và không có bọt khí.

– Quan sát dưới kính hiển vi huỳnh quang với màng lọc thích hợp.

– Quy tắc phân tích theo hướng dẫn cụ thể của nhà sản xuất cho từng loại probe.

Thông thường sẽ tiến hành phân tích 100 tương bào để đưa ra kết quả cuối cùng.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

Vấn đề Nguyên nhân Cách khắc phục
Không có tín hiệu hoặc tín hiệu yếu Kính hiển vi không thích hợp hoặc có sự cố Kiểm tra lại kính và các vật kính
Probe không biến tính hoàn toàn Kiểm tra nhiệt độ bê âm có đúng
(73+/-1)°C
Điều kiện lai không thích hợp Kiểm tra nhiệt độ tủ ấm có đúng
37°C hay không.Tăng thời gian lai lên 1 giờ.
Điều kiện rửa không thích hợp Kiểm tra nhiệt độ bể ẩm có đúng 73°C

Kiểm tra các thành phần dung dịch rửa (pH…)

Xuất hiện bọt khí giữa tiêu bản và coverslip Loại bỏ bọt khí
Bảo quản probe không đúng cách Bảo quản probe ở -20°C, không ánh sang
Tín hiệu đặc trưng yếu Điều kiện lai không thích hợp Kiểm tra nhiệt đồ tủ ẩm có đúng 37°C
Nhiệt độ dung dịch rửa quá thấp Duy trì nhiệt độ dung dịch rửa ở (73+/-1)°C
Nền quá bẩn Tiêu bản làm già quá mức cho phép hoặc chứa nhiều tế bào chất Tăng thời gian biến tính của tiêu bản lên 10 phút
Tiêu bản không sạch hoặc nhiều mảnh vỡ tế bào trên tiêu bản Chuẩn bị lại tiêu bản
Các mảnh ADN không sạch Thực hiện lại bước rửa tiêu bản sau khi lai với formamide
Dung dịch rửa sai thành phần và nhiệt độ Kiểm tra lại dung dịch rửa
Hình thái các tế bào bị co cụm, biến dạng Để tiêu bản bị quá khô Tăng độ âm hoặc tăng nhiệt độ bê ấm trong quá trình tiến hành thí nghiệm
Tiêu bản chưa được sấy khô trước khi biến tính Chuẩn bị lại xét nghiệm với tiêu bản mới

Làm già tiêu bản trước khi tiến hành
FISH 24 giờ

Tiêu bản chưa khô sau biến tính Sây tiêu bản ở nhiệt độ 45°C trong 10-15 phút sau biến tính
Nhiệt độ bể ẩm quá cao Kiểm tra nhiệt độ bể ẩm có đúng (73+/-1)°C
Thời gian biến tính quá lâu Giảm thời gian biến tính 1 phút
Tín hiệu quá mạnh Nồng độ probe sử dụng quá cao so với dải màu của KHV Cố gắng chỉnh kính thay thế bằng các dải màu trung lập

 

TÀI LIỆU THAM KHẢO

1. Tài liệu hướng dẫn sử dụng các công ty Abbott, MetaSystem.

2. Lynda J. Cambell (2011). “Fluorescence in situ hybridization on formalin-fixed paraffin-embedded tissue sections”. Cancer Cytogenetics: Methods and Protocols, Human Press, p. 189-203.

XÉT NGHIỆM VIRUS ZIKA BẰNG KỸ THUẬT PCR

I. NGUYÊN LÝ

Quy trình xét nghiệm vi rút ZIKA dựa trên xét nghiệm phát hiện vật liệu di truyền bằng phương pháp sinh học phân tử, phương pháp này có thể là phản ứng chuỗi polymerase (PCR) hoặc phản ứng chuỗi polymerase thời gian thực (realtime PCR). Hiện nay, kỹ thuật Realtime RT-PCR hay RT-PCR đã trở thành một công cụ được ứng dụng rộng rãi trong các lĩnh vực của y sinh học đặc biệt là lĩnh vực chẩn đoán bệnh với các tác nhân là vi rút.

* Kỹ thuật RT-PCR

– RNA tổng số được tách từ mẫu bệnh phẩm lâm sàng nghỉ nhiễm ZIKA. Sau đó, RNA được cho vào hỗn hợp RT-PCR với các cặp mồi đặc hiệu cho vi rút ZIKA. RNA có thể được tách chiết từ mẫu bệnh phẩm lâm sàng (máu, huyết thanh…) hoặc từ dịch nổi nuôi cấy tế bào.

* Kỹ thuật realtime RT-PCR

– Quy trình xét nghiệm vi rút ZIKA dựa trên xét nghiệm phát hiện vật liệu di truyền bằng phương pháp sinh học phân tử, phương pháp này là phản ứng chuỗi polymerase thời gian thực (realtime PCR). Hiện nay, kỹ thuật Realtime RT-PCR đã trở thành một công cụ được ứng dụng rộng rãi trong các lĩnh vực của y sinh học đặc biệt là lĩnh vực chẩn đoán bệnh với các tác nhân là vi rút. Phương pháp này sử dụng thêm bộ mẫu dò phát huỳnh quang (probe) có khả năng phát hiện sản phẩm (vật liệu di truyền của vi rút) trong quá trình tổng hợp sản phẩm. Mẫu dò là một đoạn oliognucleotit (vd: Taqman® probe) được gắn với một chất nhuộm phát tín hiệu huỳnh quang ở đầu 5′ (R), đầu kia thì được gắn với thuốc nhuộm dập tắt huỳnh quang (Q). Khi mẫu dò còn nguyên vẹn, Q có vai trò nhận năng lượng phát ra từ R (hiệu ứng chuyển năng lượng huỳnh quang). Nếu có trình tự đích, mẫu dò và mồi sẽ gắn vào khuôn, quá trình tổng hợp bắt đầu. Trong quá trình tổng hợp, enzym Taq DNA polymerase với hoạt tính exonuclease sẽ cắt các nucleotid của mẫu dò từ đầu 5′, giải phóng R khỏi Q, làm tăng tín hiệu huỳnh quang của R. Càng nhiều sản phẩm tạo thành thì càng nhiều mẫu dò bị phân cắt và tín hiệu của R phát ra càng nhiều. Mắt đọc tín hiệu huỳnh quang của máy sẽ thu tín hiệu R, xử lý bằng phần mềm và đưa ra kết quả cuối cùng.

II. CHỈ ĐỊNH

Các trường hợp nghi ngờ nhiễm virus ZIKA.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên xét nghiệm đã được đào tạo thực hiện kỹ thuật;

– Trưởng khoa hoặc người được ủy quyền duyệt kết quả.

2. Phương tiện – Hóa chất

2.1. Điều kiện bảo quản

2.1.1. Hóa chất và sinh phẩm

– Hóa chất sinh phẩm sử dụng trong phản ứng sinh học phân tử phải được bảo quản theo khuyến cáo của nhà sản xuất để đảm bảo tính ổn định của hóa chất/sinh phẩm.

– Khi sử dụng sinh phẩm cho pha chế, phải luôn được giữ lạnh và cất lại ngay sau khi dùng xong.

2.1.2. Dụng cụ tiêu hao và trang thiết bị

– Dụng cụ tiêu hao trong phòng thí nghiệm được bảo quản luôn thông thoáng. Khi sử dụng sẽ được ghi chép thông tin trong biểu mẫu phiếu theo dõi vật tư.

– Trang thiết bị trong phòng thí nghiệm được bảo quản và vận hành trong khoảng nhiệt độ từ 25±5°C, độ ẩm từ 45-90%.

2.2. Hóa chất và sinh phẩm

2.2.1. Hóa chất

– Cồn tuyệt đối;

– Dung dịch đệm TBE x10;

Thạch điện di.

2.2.2. Sinh phẩm

– QIAGEN Onestep RT-PCR: sinh phẩm dùng trong phản ứng RT-PCR

+ Đệm PCR 5X (RT-PCR Bufer, 5x).

+ dNTP: gồm dATP, dCTP, dGTP, dTTP, ở nồng độ 10mM.

+ Enzym Mix (Omniscript TM, Sensiscript TM và HotStarTaq DNA
polymeraza).

+ Nước cất tỉnh sạch (RNase-Free Water).

– QuantiTect Probe RT-PCR kit Qiagen: Sinh phẩm dung cho phản ứng
Realtime RT-PCR.

+ 2x QuantiTect Probe RT-PCR Master Mix.

+ QuantiTect RT Mix 0.5 µl.

+ Nước cất tỉnh sạch (RNase-Free Water).

– Bộ mồi cho phản ứng RT-PCR

Mồi Vị trí Trình tự (5’-3’) Nồng độ
Nhóm
Flavivirus
cFD2 NS5 GTGTCCCAGCCGGCGGTGTCATCAGC 50 uM
MAMD NS5 ACATGATGGGRAARAGRGARAA 50 uM
ZIKA nhóm
chung
ZIKVF 1538-
1558
GCTGGDGCRGACACHGGRACT 50 uM
ZIKVR 1902-
1883
RTCYACYGCCATYTGGRCTG 50 uM
ZIKA nhóm
Asia
ZIKVF9027a 9121-
9141
CCTTGGATTCTTGAACGAGGA 50 uM
ZIKVR9197c 9312-
9290
AGAGCTTCATTCTCCAGATCAA 50 uM

 

– Bộ mồi cho phản ứng real-time RT-PCR

Trình tự các cặp mồi và probe cho ZIKA

Mồi và probe Trình tự (5′-3′) Nồng độ
Mồi định chung các nhóm (Genotype) Zika1087 5′-CCGCTGCCCAACACAAG-3′ 100µM
Zika1108FAM 5′-AGCCTACCTTGACAAGCAGTCAGACACTCAA-3′ 100µM
Zika1163c 5′-CCACTAACGTTCTTTTGCAGACAT-3′ 25 µM
Mồi định nhóm Asian Genotype Zika4481 5′-CTGTGGCATGAACCCAATAG-3′ 100µM
Zika4507cFAM 5′-CCACGCTCCAGCTGCAAAGG-3 100µM
Zika4552c 5′ -ATCCCATAGAGCACCACTCC-3′ 25µM

2.2.3. Chứng chuẩn:

– Chứng dương (Positive control – POS): ZIKA

– Chứng âm (No Template Control – NTC): sử dụng nước cất để kiểm tra qua trình pha sinh phẩm hóa chất

– Chứng âm tách chiết (Negative Extraction Control – NEC): sử dụng nước cất để kiểm tra quá trình tách chiết

2.3. Dụng cụ tiêu hao và trang thiết bị

2.3.1. Dụng cụ tiêu hao

– Dụng cụ cho lấy mẫu

+ Túi/hộp để đóng gói bệnh phẩm;

+ Băng, gạc có tẩm chất sát trùng;

+ Trang phục bảo hộ (găng tay, khẩu trang…);

+ Bình lạnh bảo quản mẫu;

+ Bơm tiêm 5 ml, vô trùng;

+ Tube lấy máu (không có chất chống đông);

+ Dây garo, bông, cồn bút ghi …;

+ Tube bảo quản mẫu ở -20°C;

+ Hộp giấy đựng mẫu ở -20°C.

– Dụng cụ cho xét nghiệm

+ Tube ly tâm 1.5 ml vô trùng;

+ Tube ly tâm 2.0 ml vô trùng;

+ Pippetman: 10; 20; 100; 200 và 1000 µl;

+ Đầu côn lọc: 10; 30; 100; 200 và 1000 µl;

+ Tube tiệt trùng: 0.2; 0.5 và 1.7 ml;

+ Giá tích lạnh;

+ Tube 0,2 ml có nắp dành cho realtime RTPCR;

+ Khay chạy điện di 100-250 ml và lược;

+ Lò vi sóng 850-1300 W;

+ Cốc đong 100-300 ml;

+ Đĩa microtitre hoặc giấy parafilm;

+ Bể nhuộm gel (nếu cần thiết).

2.3.2. Trang thiết bị

– Pipet;

– Máy lắc;

– Lò sấy;

– Cân điện tử;

– Máy luân nhiệt;

– Bể điện di;

– Máy chụp Gel;

– Máy ly tâm;

– Tủ an toàn;

– Tủ lạnh.

3. Mẫu bệnh phẩm

– Loại mẫu: huyết thanh, máu toàn phần, dịch tiết….

– Điều kiện bảo quản: bảo quản lạnh.

– Bảo quản tại nơi lấy mẫu: bảo quản bệnh phẩm tại nơi lấy mẫu từ 2°C- 8°C, trong vòng 3 ngày mẫu sẽ được chuyển tới PTN, trong quá trình vận chuyển đến PTN giữ tại 2°C-8°C.

V. CÁC BƯỚC TIẾN HÀNH

1. Tách chiết mẫu

1. Kiểm tra độ đồng nhất 560 µl đệm AVL có chứa chất mang ARN trong tube 2 ml.

2. Thêm 140 µl mẫu vào 560 µl dung dịch ly giải virut AVL có chất mang ARN.

3. Trộn bằng máy trộn khoảng 15 giây, để tạo một hỗn dịch đồng nhất giữa mẫu và đệm AVL, ủ ở nhiệt độ phòng 10 phút đảm bảo các hạt virut bị ly giải hoàn toàn, ARN của virut bị ly giải được gắn vào chất mang ARN.

4. Ly tâm nhanh tube hỗn hợp khoảng 10 giây bằng máy ly tâm MICROFUGE để tất cả các dung dịch không dính trên nắp tube. Thêm 560µl Ethanol (96-100%) vào mỗi tube, trộn đều bằng máy trộn trong 15 giây, Ethanol sẽ tủa các sợi ARN.

5. Ly tâm nhanh khoảng 10 giây.

6. Cho 630 µl hỗn dịch trên vào cột QIAamp, ly tâm 8.000 vòng trong 1 phút.
Tất cả ARN sẽ được gắn trên bề mặt màng Silicagel với sự có mặt của chất mang ARN. Chuyển cột sang tube 2ml mới.

7. Mở nắp cột QIAamp, lặp lại bước 6.

8. Mở nắp cột QIAamp, thêm 500µl đệm AW1. Đóng nắp và ly tâm 8.000 vòng trong 1 phút. Chuyển cột spin sang tube 2ml sạch và loại bỏ tube có chứa dịch lọc. AW 1 có tác dụng loại bỏ các thành phần không phải là ARN có trên mặt màng Silicagel.

9. Mở nắp cột QIAamp, thêm 500µl đệm AW2. Đóng nắp và ly tâm trong khoảng từ 12.000 vòng đến 14.000 vòng trong 3 phút. Chuyển cột QIAamp sang tube2ml sạch và loại bỏ tube có chứa dịch lọc. Và ly tâm thêm 1 phút ở tốc độ từ 12.000 vòng đến 14.000 vòng để loại bỏ hoàn toàn đệm AW2.

10. Chuyển cột spin QIAamp vào tube ly tâm sạch 1.5ml và loại bỏ tube chứa dịch lọc cũ.

11. Mở nắp cột spin QIAamp, thêm 60µl đệm AVE và ủ ở nhiệt độ phòng trong 1 phút. Ly tâm 8.000 vòng trong 1 phút để toàn bộ ARN tách khỏi màng Silicagel. Sau khi ly tâm toàn bộ ARN của mẫu sẽ được thu hồi trong dịch lọc.

12. Lưu giữ ở -20°C hoặc -80°C trong thời gian 6-12 tháng.

2. Pha chế hóa chất/sinh phẩm

– Mã hóa loạt pha chế

Loại pha Ký hiệu
Cặp mồi pri
Đoạn dò (Probe) prb
Sinh phẩm cho phản ứng RT-PCR pcr
Sinh phẩm cho phản ứng Real-time RT-PCR rtm
Thạch điện di gel

 

3. Pha thạch điện di

– Số lượng thành phần garose được chuẩn bị:

Nồng độ Agarose 1% 2,5%
TBE x 1 (ml) 100 100
Agarose (g) 1 2,5
Ethidium bromid 10mg/ml (µL) 10 10

 

– Cách đổ thạch:

+ Đổ thạch bằng khay điện di có cài sẵn răng lược.

+ Lượng Agarose và TBE phụ thuộc vào nồng độ thạch và số lượng khuôn thạch cần chuẩn bị được tính theo bảng trên.

Ví dụ: Chuẩn bị 100 ml thạch 2,5%: cần 2,5 g Agarose bột và 100ml TBE.

Cho Agarose bột và dung dịch TBE vào cốc thuỷ tinh. Làm tan Agarose bằng lò vi sóng trong khoảng 3-4 phút, đảm bảo Agarose tan hoàn toàn.

+ Để nguội khoảng 50-60°C rồi cho 10 µl Ethidium bromide lắc đều, đồ dung dịch Agarose này vào khuôn điện di có cài sẵn răng lược. Sau khoảng 60 phút ở nhiệt độ phòng, khi gel đã đông, gỡ nhẹ nhàng răng lược ra. Bảo quản gel ở 4°C.

– Đặt tên cho loạt pha.

4. Pha cặp mồi cho phản ứng

– Nồng độ mồi tính theo đơn vị nmole (ghi trên tube mồi đông khô).

– Trả lại nước khử ion theo khuyến cáo của nhà sản xuất để đạt nồng độ gốc.

– Nồng độ mồi sử dụng được pha từ nồng độ gốc.

– Chia ra các tube có thể tích từ 50 – 200 µl /1 loại mồi/mẫu dò và bảo quản tại – 30°C.

– Đặt tên cho loạt pha

5. Pha sinh phẩm cho phản ứng RT-PCR

Thành phần pha sinh phẩm cho phản ứng RT-PCR.

TT Sinh phẩm Thể tích (µl) Số lượng phản ứng (N)
1 Đệm PCR x5 4 4xN
2 Enzym 0.8 0.8xN
3 dNTPs 0.8 0.8xN
4 Mồi xuôi 0.2 0.2xN
5 Mồi ngược 0.2 0.2xN
6 Nước cất tinh sạch 9 9xN
Tổng số 15
7 ARN mẫu 5
Tổng số 20

 

– Đặt tên cho loạt pha

6. Pha sinh phẩm cho phản ứng Realtime-RT-PCR

Thành phần pha sinh phẩm cho phản ứng Realtime RT-PCR

TT Thành phần Nồng độ Thể tích (µl)/1 pư Số lượng phản ứng (N)
1 2x Reaction mix 12.5 12.5xN
2 QuantiTect RT mix 0.25 0.25xN
3 Mồi xuôi 100 µM 0.25 0.25xN
4 Mồi ngược 100 µM 0.25 0.25xN
5 Probe 25 µM 0.15 0.15xN
6 Nước tinh sạch 6.6 6.6xN
Tổng 20
7 RNA 5
Tổng 25

– Đặt tên cho loạt pha

7. Quy trình RT-PCR

Cài đặt thiết bị

– Cài đặt thiết bị cho máy PCR

– Chu trình nhiệt cho ZIKA nhóm chung:

Nhiệt độ (oC) Thời gian Chu kỳ lặp Tên chương trình
ZIKA nhóm chung

 

 

50 30:00 x 1 ZIKA

 

 

95 15:00
95 0:30 } x 35
55 0:30
72 0:45
72 7:00 X 1
10

 

– Chu trình nhiệt cho ZIKA nhóm Asia:

Nhiệt độ (oC) Thời gian Chu kỳ lặp Tên chương trình
ZIKA nhóm Asia 50 30:00 x 1 ZIKA-ASI
95 15:00
94 0:15 } x 35
57 0:25
72 0:20
72 5:00 X1
10

 

Tra mẫu và chay máy

– Cho 5 µl mẫu RNA bệnh phẩm vào hỗn hợp sinh phẩm đã chuẩn bị cho phản ứng RT-PCR.

Mẫu chứng dương: được thực hiện tại tủ an toàn mẫu.

– Đặt các tube vào máy, khởi động và kiểm tra chương trình trước khi chạy máy luân nhiệt cổ điển theo yêu cầu xét nghiệm.

– Ghi chép mã thiết bị sử dụng, block sử dụng (nếu có), ngày sử dụng vào (VR- 5.3-QTQL.01-BM.05).

– Sau khi kết thúc quá trình chạy máy, mang các mẫu sang phòng điện di và tiến hành điện di sản phẩm RT-PCR.

Điện di sản phẩm

– Chuyển sản phẩm PCR vào thạch

+ Đặt thạch vào bể điện di theo đúng chiều dòng điện từ âm sang dương rồi cho TBE 1X ngập bản thạch sao cho dung dịch đệm cách mặt thạch từ 1-2mm.

+ Cho dung dịch đệm đặt mẫu (Loading Dye) vào từng giếng của đĩa microtitre hoặc trên giấy parafilm với số lượng tương ứng với số mẫu cần phân tích. Đệm Loading chứa 50% Glycerol vì vậy có tác dụng kéo ADN xuống dưới đáy của giếng điện di và còn chứa Bromophenol Blue có tác dụng đánh dấu ADN trong quá trình chạy.

+ Trộn 9 µl mỗi sản phẩm PCR với 1 µl đệm đặt mẫu.

+ Trộn 4 – 5 µl thang chuẩn ADN 100bp hoặc 1000 bp với 1 µl đệm đặt mẫu.

+ Chuyển dung dịch đã được trộn với nhau vào trong các giếng của bản thạch.

+ Đóng nắp của bể điện di, chọn dòng điện 110V và thời gian 30 phút.

+ Tắt máy điện di, chuyển thạch sang máy đọc

– Soi và chụp ảnh

+ Đặt bản thạch ngay ngắn trên máy đọc gel, bật đèn tím để đọc gel và chụp ảnh.

8. Quy trình real-time RT-PCR

Cài đặt thiết bị

– Cài đặt chương trình cho máy Realtime PCR

Nhiệt độ (oC) Thời gian Chu kỳ lặp Tên chương trình
ZIKA 50 30:00 x 1 ZIKV.CDC.Lancioti
95 15:00
95 0:15 } x 45
60 1:00
Thu tín hiệu huỳnh quang
10

 

Tra mẫu và chay máy

– Cho 5µl mẫu RNA bệnh phẩm vào tube chứa hỗn hợp phản ứng realtime RT- PCR, ly tâm nhanh và giữ trong giá tích lạnh.

– Khi tra mẫu phải nhập mã số mẫu vào sơ đồ vị trí khung 96 giếng.
Chú ý: Nếu chưa chạy ngay thì nên giữ tube ở điều kiện 4°C.

– Đặt các tuýp vào máy, khởi động chương trình theo yêu cầu xét nghiệm.

VI. NHẬN ĐỊNH KẾT QUẢ

1.Nhận định kết quả RT-PCR

– Kết quả được chấp nhận khi:

+ Chứng dương: có băng đặc hiệu tương đương với kích thước của cặp mồi thiết kế.

+ Chứng âm phản ứng (NTC), chứng âm tách chiết (NEC): âm tính.

– Âm tính: sự xuất hiện sản phẩm PCR ở các vị trí không đặc hiệu hoặc không có sự hiện diện của sản phẩm PCR.

– Dương tính: sản phẩm PCR đặc hiệu có kích thước theo đúng kích thước chuẩn.

– Kích thước sản phẩm PCR đặc hiệu.

Dương tính
RT-PCR
Nhóm Flavivirus 250 bp
Zika nhóm chung 364 bp
Zika nhóm Asia 192 bp

 

– Trong trường hợp kết quả của phương pháp RT-PCR không cho kết quả rõ ràng hoặc trong trường hợp cần khẳng định chính xác kết quả, phòng thí nghiệm sẽ xét nghiệm bằng phương pháp Realtime RT-PCR.

2. Nhận định kết quả Realtime-PCR

– Kết quả chỉ đọc được khi:

+ Chứng âm: không có tín hiệu huỳnh quang.

+ Chứng âm tách chiết: không có tín hiệu huỳnh quang.

+ Mẫu dương tính: tín hiệu huỳnh quang được thu nhận trước hoặc tại chu kỳ thứ 38 của phản ứng.

– Nếu trong trường hợp phương pháp Realtime RT-PCR vẫn cho kết quả không rõ thì mẫu bệnh phẩm này sẽ được lặp lại từ bước tách chiết mẫu và có thể chạy song song hai phương pháp RT-PCR và Realtime PCR; hoặc PTN có thể yêu cầu lấy lại bệnh phẩm và xét nghiệm theo thường quy của phòng từ bước nhận bệnh phẩm.

Ghi chép và báo cáo

TÀI LIỆU THAM KHẢO

1. QIAGEN One Step RT-PCR Kit Handbook, 2002.

2. QuantiTect® Probe RT_PCR Handbook.2011.

3. A Diagnostic Polymerase Chain Reaction Assay for Zika Virus Michelle N.D. Balm, Chun Kiat Lee, Hong Kai Lee, Lily Chiu, Evelyn S.C. Koay, and Julian W. Tang.

4. One-step RT-PCR for detection of Zika virus Oumar Faye, Ousmane Faye, Anne Dupressoir, Manfred Weidmann, Mady Ndiaye, Amadou Alpha Sall.

5. Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007 Robert S. Lanciotti, Olga L. Kosoy, Janeen J. Laven, Jason O. Velez, Amy J. Lambert, Alison J. Johnson, Stephanie M. Stanfield, and Mark R. Duffy.

CHƯƠNG IV: QUY TRÌNH HUYẾT THANH HỌC NHÓM MÁU

XÁC ĐỊNH KHÁNG NGUYÊN Mia CỦA HỆ NHÓM MÁU MNS  (Kỹ thuật ống nghiệm)

Determination Miª antigen of MNS system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên Miª của hệ nhóm máu MNS được dựa trên nguyên lý của phản ứng ngưng kết, sử dụng thuốc thử kháng globulin người (huyết thanh Coombs) để xác định sự có mặt của kháng thể chống Mĩ loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Miª [1], [2].

II. CHỈ ĐỊNH

Xác định kháng nguyên Miª của hệ MNS: Được chỉ định giống như chỉ định xác định kháng nguyên C của hệ Rh (Kỹ thuật ống nghiệm) [4].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện:

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao:

Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên Kpa của hệ Kell [4].

2.2. Thuốc thử và hoá chất:

Thuốc thử Anti-Miª loại IgG; nước muối sinh lý 0,9%; nước cất, thuốc thử kháng globulin người…

2.3. Mẫu máu để xác định kháng nguyên Miª của hệ MNS:

Gồm một ống máu tĩnh mạch được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người bệnh/ người hiến máu cần xác định kháng nguyên Miª.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Miª, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Miª với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Miª của hệ nhóm máu MNS: Được thực hiện theo hướng dẫn sử dụng anti-Miª loại IgG [2], các bước được tiến hành tương tự với các bước xác định kháng nguyên Kp của hệ Kell [4].

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: Có kháng nguyên Miª trên bề mặt hồng cầu.

– Phản ứng không ngưng kết: Không có kháng nguyên Miª trên hồng cầu.

Những điểm cần chú ý khi làm xét nghiệm:

– Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh và xác định kháng nguyên Kpa của hệ Kell [3], [4].

– Làm đúng hướng dẫn sử dụng anti-Miª loại IgG của nhà sản xuất [2].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

2. Hướng dẫn sử dụng anti Miª IgG.

3. Thông tư 26/2013/TT-BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

4. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà – xuất bản Y học, năm 2014.

XÁC ĐỊNH KHÁNG NGUYÊN MIª CỦA HỆ NHÓM MÁU MNS (Kỹ thuật gelcard)

Determination Miª antigen of MNS system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên Miª của hệ nhóm máu MNS bằng ký thuật gelcard được dựa trên nguyên lý của phản ứng ngưng kết cột gel, sử dụng thuốc thử kháng globulin người (huyết thanh Coombs) để xác định sự có mặt của kháng thể chống Miª loại IgG đã được cảm nhiễm trên bề mặt hồng cầu của những cá thể mang kháng nguyên Miª [1], [2].

II. CHỈ ĐỊNH

Xác định kháng nguyên Miª của hệ MNS: Được chỉ định giống như chỉ định xác định kháng nguyên C của hệ Rh (Kỹ thuật ống nghiệm) [4].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

Trang thiết bị: Máy ủ, máy ly tâm, máy đọc gelcard chuyên dụng; máy ly tâm ống thẳng có số vòng chính xác; tủ lạnh đựng sinh phẩm…;

Dụng cụ: Ông nghiệm thủy tinh (12×75 mm); giá cắm ống nghiệm; khay men hình chữ nhật; pipette nhựa; pipette tự động; đầu côn các loại; hộp đựng đầu côn; giá nhựa để gelcard; bút marker viết nhăn…

2.2. Thuốc thử và hoá chất

– Kháng huyết thanh Anti-Miª loại IgG; nước muối sinh lý 0,9%; nước cất…;

– Tấm gelcard AHG loại IgG, dung dịch pha hồng cầu (Đệm Liss) để làm
xét nghiệm trên gelcard.

2.3. Mẫu máu để xác định kháng nguyên Miª của hệ MNS

Gồm một ống máu tĩnh đã mạch được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị đầy đủ trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên Miª, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên Mĩ với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên Miª của hệ nhóm máu MNS

Bước 1: Chuẩn bị dung dịch hồng cầu cần xác định kháng nguyên Miª 1% (1000 µl dung dịch pha loãng hồng cầu và 10 µl hồng cầu khối của người bệnh hoặc người cần xác định kháng nguyên Miª);

Bước 2: Ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên Mi lên trên cột gel của tấm gelcard.

Bước 3: Mở tấm bảo vệ phủ trên các cột gel theo đúng quy định;

Bước 4: Nhỏ 50 µl dung dịch hồng cầu người bệnh hoặc người hiến máu 1% đã được chuẩn bị ở bước 1 vào cột gel đã được ghi nhãn (bước 2);

Bước 5: Thêm 25 µl thuốc thử anti Miª vào cột gel tương ứng đã được nhỏ hồng cầu ở bước 4;

Bước 6: Ủ tấm gelcard ở điều kiện nhiệt độ 37°C trong vòng 15 phút trên máy ủ gelcard chuyên dụng;

Bước 7: Hết giai đoạn ủ, ly tâm tấm gelcard trên máy ly tâm gelcard
chuyên dụng trong 10 phút;

Bước 8: Đọc kết quả trên máy đọc gelcard chuyên dụng theo phần mềm đã được cài đặt và theo hướng dẫn của nhà sản xuất;

Bước 9: Lưu kết quả vào file kết quả của phần mềm máy tính chuyên dụng và số kết quả xác định kháng nguyên nhóm máu;

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: Có kháng nguyên Miª trên bề mặt hồng cầu.

– Phản ứng không ngưng kết: Không có kháng nguyên Miª trên hồng cầu.

Những điểm cần chú ý khi làm xét nghiệm:

– Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh [3], [4].

– Làm đúng hướng dẫn sử dụng anti-Miª loại IgG của nhà sản xuất [2].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion
practices, fourth edition, Book Promotion & Service Co., LTD.

2. Hướng dẫn sử dụng anti Miª loại IgG.

3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về “Hướng dẫn hoạt động truyền máu”.

4. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà xuất bản Y học, năm 2014.

XÁC ĐỊNH KHÁNG NGUYÊN H CỦA HỆ NHÓM MÁU H (Kỹ thuật ống nghiệm)

Determination H antigen of H system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên H của hệ nhóm máu H được dựa trên nguyên lý của phản ứng ngưng kết. Anti-H loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên H [1], [2].

II. CHỈ ĐỊNH

Xác định kháng nguyên H được chỉ định trong những trường hợp người bệnh và người hiến máu có nhóm máu hệ ABO khó xác định, những cá thể này trên hồng cầu hoặc trong chất tiết không mang kháng nguyên H, A, B và trong huyết thanh của họ có thể có anti- H, anti-A₁ [1], [2].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện, thuốc thử, mẫu máu xét nghiệm

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh [5].

2.2. Thuốc tử và hóa chất:

Thuốc thử anti- H loại IgM; Nước muối sinh lý; Nước cất…

2.3. Mẫu máu để xác định kháng nguyên H

Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Chuẩn bị 1 ống nghiệm sạch, khô. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên H.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên H: Kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên H với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên H: Được thực hiện theo hướng dẫn sử dụng anti-H loại IgM [3], các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh (kỹ thuật ống nghiệm) [5]

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: có kháng nguyên H trên hồng cầu;

– Phản ứng không ngưng kết: không có kháng nguyên H trên hồng cầu.

Những điểm cần chú ý khi làm xét nghiệm

– Làm theo đúng hướng dẫn sử dụng anti-H loại IgM của nhà sản xuất [3];

– Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh (kỹ thuật ống nghiệm) [4], [5].

TÀI LIỆU THAM KHẢO

1. Bùi Thị Mai An (2010), Đặc điểm một số nhóm máu hệ hồng cầu và mối liên quan với bệnh lý, Một số chuyên để Huyết học – Truyền máu tập 3, Nhà xuất bản Y học.

2. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

3. Hướng dẫn sử dụng anti- H loại IgM của Nhà sản xuất sinh phẩm.

4. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về “Hướng dẫn hoạt động truyền máu”.

5. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà xuất bản Y học, năm 2014.

XÁC ĐỊNH KHẲNG NGUYÊN H CỦA HỆ NHÓM MÁU H (KỸ THUẬT GELCARD)

Determination H antigen of H system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên H bằng kỹ thuật gelcard được dựa trên nguyên lý của phản ứng ngưng kết cột gel. Kháng thể đặc hiệu chống lại kháng nguyên H có sẵn trong cột gel sẽ cho phản ứng ngưng kết với hồng cầu mang kháng nguyên H khi được ly tâm bằng máy ly tâm chuyên dụng. Nếu trên hồng cầu không mang kháng nguyên H thì sẽ không cho phản ứng ngưng kết sau khi ly tâm [1], [2], [3].

II. CHỈ ĐỊNH

Xác định kháng nguyên H được chỉ định trong những trường hợp người bệnh và người hiến máu có nhóm máu hệ ABO khó xác định, những cá thể này trên hồng cầu hoặc trong chất tiết không mang kháng nguyên H, A, B và trong huyết thanh của họ tiềm ẩn có thể có anti- H, anti-A1 [1], [2].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

– Trang thiết bị: Máy ủ, máy ly tâm, máy đọc gelcard chuyên dụng; máy ly tâm ống thẳng có số vòng chính xác; tủ lạnh đựng sinh phẩm…;

– Dụng cụ: Ống nghiệm thủy tinh (12×75 mm); giá cắm ống nghiệm; khay men hình chữ nhật; pipette nhựa; pipette tự động; đầu côn các loại; hộp đựng đầu côn; giá nhựa để tấm gelcarrd; bút marker…

2.2. Thuốc thử và hoá chất

Tấm gelcard có sẵn anti-H Lectin và dung dịch đệm thích hợp trong cột
gel để xác định kháng nguyên H; đệm LISS pha hồng cầu 1% để làm xét nghiệm gelcard; nước muối sinh lý 0,9%; nước cất…

2.3. Mẫu máu để xác định kháng nguyên H của hệ nhóm máu H
Gồm một ống máu tĩnh đã mạch được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị đầy đủ trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên H, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên H với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu. Trước khi làm xét nghiệm mẫu máu phải được ly tâm ở 1500 vòng trong vòng 10 phút để tránh fibrin còn lại trong mẫu máu có thể gây ảnh hưởng tới kết quả.

3. Chuẩn bị mẫu máu làm xét nghiệm: Chuẩn bị dịch treo hồng cầu 1%

– Mang dung dịch pha hồng cầu để làm xét nghiệm (Đệm LISS) về nhiệt độ phòng trước khi sử dụng;

– Phân phối 1ml đệm LISS vào một ống nghiệm sạch;

– Thêm 10 µl khối hồng cầu cần xác định kháng nguyên H vào ống nghiệm trên và trộn đều;

– Sử dụng dung dịch hồng cầu đã pha ở trên để xác định kháng nguyên H.

4. Tiến hành xác định kháng nguyên H của hệ nhóm máu H:

Bước 1: Ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên H lên trên cột gel của tấm gelcard: Tên, mã số người bệnh;

Bước 2: Mở tấm bảo vệ phủ trên các cột gel theo đúng quy định;

Bước 3: Nhỏ 50 µl dung dịch hồng cầu 1% của người bệnh hoặc người hiến máu vào cột gel thích hợp đã được ghi nhãn (bước 1);

Bước 4: Thêm 25 µl enzyme papain vào cột gel tương ứng đã được nhỏ hồng cầu ở bước 3;

Bước 5: Ủ tấm gelcard ở điều kiện nhiệt độ phòng trong vòng 10 phút trên máy ủ gelcard chuyên dụng;

Bước 6: Hết giai đoạn ủ, ly tâm tấm gelcard trên máy ly tâm gelcard chuyên dụng trong 10 phút;

Bước 8: Đọc kết quả trên máy đọc gelcard chuyên dụng theo phần mềm đã được cài đặt và theo hướng dẫn của nhà sản xuất;

Bước 9: Lưu lại kết quả trên máy đọc gelcard chuyên dụng và ghi kết
quả vào sổ lưu kết quả;

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: Có kháng nguyên H trên bề mặt hồng cầu;

– Phản ứng không ngưng kết: Không có kháng nguyên H trên hồng cầu.

Những điểm cần chú ý khi làm xét nghiệm:

– Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh [3], [4];

– Thực hiện theo đúng hướng dẫn sử dụng anti-H của nhà sản xuất [2].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

2. Hướng dẫn sử dụng anti Miª loại IgG.

3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về “Hướng dẫn hoạt động truyền máu”.

4. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà xuất bản Y học, năm 2014.

XÁC ĐỊNH KHÁNG NGUYÊN A1 CỦA HỆ NHÓM MÁU ABO
( KỸ THUẬT ỐNG NGHIỆM)
Determination A1 antigen of ABO system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên A₁ của hệ nhóm máu ABO được dựa trên nguyên lý của phản ứng ngưng kết. Anti-A₁ loại IgM sẽ gây ngưng kết trực tiếp hồng cầu của những cá thể mang kháng nguyên A₁, những hồng cầu mà ngưng kết với anti-A₁ là có nhóm máu A₁, còn những hồng cầu không ngưng kết với anti A₁ là có nhóm máu A2 [1], [2].

II. CHỈ ĐỊNH

Xác định kháng nguyên A₁ được chỉ định để xác định những trường hợp người bệnh và người hiến máu có nhóm máu thuộc dưới nhóm của nhóm máu A (A2, Ax, A2B…) [1], [2]. III.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện, thuốc thử, mẫu máu xét nghiệm

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

Giống như trang thiết bị, dụng cụ, vật tư tiêu hao của quy trình xác định kháng nguyên C của hệ Rh [5].

2.2. Thuốc tử và hóa chất

Thuốc thử anti-A₁ loại IgM; nước muối sinh lý; nước cất…

2.3. Mẫu máu để xác định kháng nguyên A₁

Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm. Chuẩn bị 1 ống nghiệm sạch, khô. Trên ống nghiệm được đánh số hoặc ghi nhãn đầy đủ thông tin của người cần xác định kháng nguyên A₁.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên A₁: Kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên A₁ với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xác định kháng nguyên A₁: Được thực hiện theo hướng dẫn sử dụng anti- A₁ loại IgM [3], các bước tiến hành tương tự với các bước xác định kháng nguyên C của hệ Rh [5]

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: có kháng nguyên A₁ trên hồng cầu, kết luận người bệnh/ người hiến máu có nhóm máu A₁.

– Phản ứng không ngưng kết: không có kháng nguyên A₁ trên hồng cầu, kết luận người bệnh/ người hiến máu có thể có nhóm máu dưới nhóm thuộc nhóm máu A (A2, A3, Αχ…).

Những điểm cần chú ý khi làm xét nghiệm

Thực hiện theo đúng hướng dẫn sử dụng anti-A₁ loại IgM của nhà sản xuất [3].

Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh [4], [5].

TÀI LIỆU THAM KHẢO

1. Bùi Thị Mai An (2010), Đặc điểm một số nhóm máu hệ hồng cầu và mối liên quan với bệnh lý, Một số chuyên để Huyết học – Truyền máu tập 3, Nhà xuất bản Y học.

2. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

3. Hướng dẫn sử dụng anti- H loại IgM của Nhà sản xuất sinh phẩm.

4. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về “Hướng dẫn hoạt động truyền máu”.

5. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà xuất bản Y học, năm 2014.

XÁC ĐỊNH KHÁNG NGUYÊN A₁ CỦA HỆ NHÓM MÁU ABO (KỸ THUẬT GELCARD)

Determination A₁ antigen of ABO system

I. NGUYÊN LÝ

Kỹ thuật xác định kháng nguyên A₁ bằng kỹ thuật gelcard được dựa trên nguyên lý của phản ứng ngưng kết cột gel. Kháng thể đặc hiệu chống lại kháng nguyên A₁ có sẵn trong cột gel sẽ cho phản ứng ngưng kết với hồng cầu mang kháng nguyên A₁ khi được ly tâm bằng máy ly tâm gelcard chuyên dụng. Những hồng cầu mà ngưng kết với anti-A₁, là có nhóm máu A₁, những hồng cầu không ngưng kết với anti-A₁, là có thể có nhóm máu thuộc dưới nhóm của nhóm máu A [1], [2].

II. CHỈ ĐỊNH

Xác định kháng nguyên A₁ được chỉ định để xác định những trường hợp người bệnh và người hiến máu có nhóm máu thuộc dưới nhóm của nhóm A (A2, Ax, A2B…) [1], [2].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

– Trang thiết bị: Máy ủ, máy ly tâm, máy đọc gelcard chuyên dụng; máy ly tâm ống thẳng có số vòng chính xác; tủ lạnh đựng sinh phẩm…;

– Dụng cụ: Ống nghiệm thủy tinh (12×75 mm); giá cắm ống nghiệm; khay men hình chữ nhật; pipette nhựa; pipette tự động; đầu côn các loại; hộp đựng đầu côn; giá nhựa để tấm gelcarrd; bút marker…

2.2. Thuốc thử và hoá chất

Tấm gelcard có sẵn trong cột gel anti- A₁ Lectin để xác định kháng
nguyên A₁ và dung dịch đệm thích hợp; Dung dịch để pha hồng cầu 1% làm xét nghiệm (Đệm LISS); nước muối sinh lý 0,9%; nước cất…

2.3. Mẫu máu để xác định kháng nguyên A₁ của hệ nhóm máu ABO

Gồm một ống máu tĩnh đã mạch được chống đông bằng EDTA: 2 ml.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị đầy đủ trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu yêu cầu xác định kháng nguyên A₁, kiểm tra và đối chiếu các thông tin trên mẫu máu cần xác định kháng nguyên A, với phiếu yêu cầu xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu. Trước khi làm xét nghiệm mẫu máu phải được ly tâm ở 1500 trong vòng 10 phút để tránh fibrin còn lại trong mẫu máu có thể gây ảnh hưởng tới kết quả.

1. Chuẩn bị mẫu máu làm xét nghiệm: Chuẩn bị dịch treo hồng cầu 1%

– Mang dung dịch pha hồng cầu để làm xét nghiệm (Đệm LISS) về nhiệt độ phòng trước khi sử dụng;

– Phân phối 1ml đệm LISS vào một ống nghiệm sạch;

– Thêm 10 µl khối hồng cầu cần xác định kháng nguyên A₁ vào ống
nghiệm trên và trộn đều;

– Sử dụng dung dịch hồng cầu đã pha ở trên để xác định kháng nguyên A₁.

2. Tiến hành xác định kháng nguyên A₁ của hệ nhóm máu ABO

Tiến hành xác định kháng nguyên A₁ của hệ ABO: Được thực hiện theo quy trình hướng dẫn xác định kháng nguyên A₁ bằng kỹ thuật gelcard của nhà sản xuất. Các bước tiến hành tương tự như các bước của quy trình xác định kháng của H của hệ nhóm máu H bằng kỹ thuật gelcard.

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: có kháng nguyên A₁ trên hồng cầu, kết luận người bệnh/ người hiến máu có nhóm máu A₁.

– Phản ứng không ngưng kết: không có kháng nguyên A₁ trên hồng cầu, kết luận người bệnh/ người hiến máu có thể có nhóm máu dưới nhóm của nhóm máu A (A2, A3, Αχ…).

Những điểm cần chú ý khi làm xét nghiệm

– Giống như những điểm cần chú ý khi làm xét nghiệm xác định kháng nguyên C của hệ Rh [3], [4].

– Thực hiện theo đúng hướng dẫn sử dụng anti- A₁ của nhà sản xuất [2].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion
practices, fourth edition, Book Promotion & Service Co., LTD.

2. Hướng dẫn sử dụng anti Mia loại IgG.

3. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về “Hướng dẫn hoạt động truyền máu”.

4. Hướng dẫn quy trình kỹ thuật khám bệnh, chữa bệnh chuyên ngành Huyết học – Truyền máu – Miễn dịch – Di truyền – Sinh học phân tử, Bộ Y tế, Nhà xuất bản Y học, năm 2014.

XÉT NGHIỆM LỰA CHỌN ĐƠN VỊ MÁU PHÙ HỢP
(Chọn 10 đơn vị máu ở điều kiện 22°C, 37°C và kháng globulin người)
KỸ THUẬT ỐNG NGHIỆM

I. NGUYÊN LÝ

Kỹ thuật được dựa trên nguyên lý của phản ứng ngưng kết. Tiến hành lựa chọn 10 đơn vị máu cùng nhóm hệ ABO, Rh (D) với người bệnh và làm phản ứng hòa hợp ở điều kiện 22°C, 37°C và kháng globulin người (AHG), lựa chọn được đơn vị máu hòa hợp nhất để truyền cho người bệnh.

II. CHỈ ĐỊNH

– Người bệnh có kết quả phản ứng hòa hợp dương tính;

– Người bệnh thiếu máu tan máu miễn dịch;

– Người bệnh có kháng thể bất thường.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị:

Máy ly tâm thường có số vòng chính xác; kính hiển vi; bình cách thủy; tủ lạnh…

2.2. Dụng cụ:

Ống nghiệm thuỷ tinh (12x75mm); giá cắm ống nghiệm; khay men hình chữ nhật (25×30 cm); cốc thuỷ tỉnh có mỏ loại 500 ml; bút maker; pipet nhựa; bơm kim tiêm; ống nghiệm nhựa chống đông và không chống đông…

2.3. Vật tư tiêu hao:

Số chọn máu; phiếu yêu cầu chọn máu của bác sỹ lâm sàng; mũ giấy; khẩu trang; găng tay; quần áo công tác…

2.4. Thuốc thử và hoá chất:

Kháng globulin người loại IgG; hồng cầu chứng; nước muối sinh lý 0,9%.

2.5. Mẫu máu:

– Mẫu máu người bệnh: 10 ml máu tĩnh mạch không chống đông và 2 ml máu tĩnh mạch có chống đông bằng EDTA;

– Mẫu máu của 10 đơn vị máu sẽ được chọn có cùng nhóm hệ ABO, Rh (D) với người bệnh.

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị đầy đủ trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu yêu cầu lựa chọn đơn vị máu phù hợp: Kiểm tra và đối chiếu các thông tin trên mẫu máu của người bệnh với phiếu xét nghiệm yêu cầu chọn máu. Kiểm tra về số lượng và chất lượng mẫu máu của người bệnh. Kiểm tra mẫu máu của 10 đơn vị máu: Các mẫu máu của đơn vị máu phải đảm bảo không bị đông dây, không bị vỡ hồng cầu.

3. Tiến hành xét nghiệm chọn đơn vị máu phù hợp cho người bệnh

3.1. Tiến hành chọn đơn vị máu phù hợp ở điều kiện 22°C

– Bước 1: Ly tâm ống máu không chống đông của người bệnh với tốc độ 2000 vòng/phút trong vòng 3 phút để tách huyết thanh;

– Bước 2: Chọn 10 đơn vị khối hồng cầu của người cho phù hợp nhóm máu hệ ABO và Rh(D) với người bệnh;

– Bước 3: Chuẩn bị 10 ống nghiệm sạch, khô, ghi đầy đủ thông tin của từng đơn vị máu của người cho lên ống nghiệm để lấy hồng cầu từ dây túi máu của từng đơn vị túi máu;

– Bước 4: Pha hồng cầu người cho 5% trong môi trường nước muối sinh lý (1 thể tích hồng cầu khối của người cho và 19 thể tích nước muối sinh lý);

– Bước 5: Chuẩn bị 10 ống nghiệm sạch, khô, ghi nhãn với đầy đủ thông tin của người bệnh và đơn vị túi máu;

– Bước 6: Nhỏ 1 thể tích hồng cầu của người cho 5% lần lượt vào các ống nghiệm tương ứng đã được ghi nhãn ở trên;

– Bước 7: Thêm 2 thể tích huyết thanh người bệnh lần lượt vào các ống nghiệm trên và trộn đều;

– Bước 8: Ly tâm các ống nghiệm trên với tốc độ 1000 vòng/phút trong vòng 20 giây;

– Bước 9: Đọc kết quả bằng mắt thường và kính hiển vi;

– Bước 10: Ghi kết quả vào sổ chọn máu.

3.2. Tiến hành chọn đơn vị máu phù hợp ở điều kiện 37°C và AHG

– Bước 1: Chuẩn bị 10 ống nghiệm sạch, khô, ghi nhãn với đầy đủ thông tin của người bệnh và người hiến máu;

– Bước 2: Nhỏ 1 thể tích hồng cầu của người cho 5% lần lượt vào các ống nghiệm tương ứng với đơn vị túi máu đã được chuẩn bị ở trên;

– Bước 3: Thêm 2 thể tích huyết thanh người bệnh lần lượt vào các ống nghiệm trên và trộn đều;

– Bước 4: Ủ các ống nghiệm trên ở bình cách thủy 37°C trong vòng 30 phút, nếu thêm 2 giọt đệm LISS vào ống nghiệm trước khi ủ thì thời gian ủ được rút ngắn chỉ còn 15 phút;

– Bước 5: Sau khi ủ, ly tâm các ống nghiệm trên với tốc độ 1000 vòng/phút trong vòng 20 giây;

– Bước 6: Đọc kết quả chọn máu ở điều kiện 37°C bằng mắt thường và kính hiển vi;

– Bước 7: Ghi kết quả chọn máu ở điều kiện 37°C vào sổ chọn máu;

– Bước 8: Sau khi đọc kết quả ở nhiệt độ 37°C, tiếp tục rửa hồng cầu trong các ống nghiệm trên 3 lần bằng dung dịch nước muối sinh lý, lấy kiệt dịch nổi sau mỗi lần rửa;

– Bước 9: Kết thúc lần rửa cuối, nhỏ 2 giọt AHG vào mười ống nghiệm trên;

– Bước 10: Ly tâm các ống nghiệm trên với tốc độ 1.000 vòng/phút trong vòng 20 giây;

– Bước 11: Đọc kết quả bằng mắt thường và kính hiển vi. Đọc kết quả theo hướng dẫn của nhà sản xuất sinh phẩm;

– Bước 12: Nhỏ 1 giọt hồng cầu chứng vào tất cả những ống nghiệm cho kết quả âm tính ở trên (để kiểm chứng chất lượng của kháng globulin người), trộn đều, ly tâm với tốc độ 1.000 vòng/phút trong vòng 20 giây. Đọc kết quả bằng mắt thường và kính hiển vi, kết quả phải dương tính với mức độ từ 1+ đến 2+, nếu ống nghiệm nào cho kết quả âm tính thì phải lặp lại xét nghiệm từ bước 1 của phần 3.2.

– Bước 13: Ghi kết quả chọn máu vào số chọn máu.

VI. NHẬN ĐỊNH KẾT QUẢ

Chọn được đơn vị máu hòa hợp: Khi kết quả phản ứng hòa hợp giữa huyết thanh người bệnh với hồng cầu của đơn vị máu âm tính ở cả 3 điều kiện, nhiệt độ (22°C, 37°C và kháng globulin người);

– Không chọn được đơn vị máu hòa hợp: Khi kết quả phản ứng hòa hợp giữa huyết thanh người bệnh với hồng cầu của đơn vị máu dương tính với cả 10 đơn vị máu được chọn ở 1 trong 3, 2 trong 3 hoặc cả 3 điều kiện, nhiệt độ (22°C, nhiệt độ 37°C và kháng globulin người).

Những điểm cần chú ý khi làm xét nghiệm:

1. Thực hiện kiểm chứng theo quy định của thông tư 26/2013/TT-BYT về “Hướng dẫn hoạt động truyền máu” [4].

2. Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm hiện đang sử dụng.

3. Cần thực hiện kỹ thuật lựa chọn đơn vị máu phù hợp sớm sau khi lấy mẫu máu xét nghiệm của người bệnh.

4. Mẫu máu sau khi thực hiện kỹ thuật chọn đơn vị máu hòa hợp phải được lưu giữ theo đúng quy định.

TÀI LIỆU THAM KHẢO

1. Bùi Thị Mai An (2010), Đặc điểm một số nhóm máu hệ hồng cầu và mối liên quan với bệnh lý, Một số chuyên để Huyết học – Truyền máu tập 3, Nhà xuất bản Y học.

2. Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.

3. Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood
Groups, Blackwell.

4. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

XÉT NGHIỆM LỰA CHỌN ĐƠN VỊ MÁU PHÙ HỢP
(Chọn 10 đơn vị máu ở điều kiện 22°C, 37°C và kháng globulin người)
KỸ THUẬT GELCARD

I. NGUYÊN LÝ

Kỹ thuật dựa trên nguyên lý của phản ứng ngưng kết cột gel. Tiến hành lựa chọn 10 đơn vị máu cùng nhóm hệ ABO, Rh(D) với người bệnh và làm phản ứng hòa hợp ở 3 điều kiện 22°C, 37°C và kháng globulin người (AHG) bằng kỹ thuật gelcard để lựa chọn đơn vị máu hòa hợp nhất truyền cho người bệnh [1], [2], [3].

II. CHỈ ĐỊNH

Xét nghiệm lựa chọn đơn vị máu phù hợp được chỉ định trong trường hợp:

– Người bệnh có kết quả phản ứng hòa hợp dương tính;

– Người bệnh thiếu máu tan máu miễn dịch;

– Người bệnh có kháng thể bất thường.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện – Hóa chất

1.1. Trang thiết bị

Máy ủ, máy ly tâm, máy đọc gelcard chuyên dụng; Máy ly tâm ống thẳng có số vòng và thời gian chính xác để ly tâm ống máu; Tủ lạnh đựng sinh phẩm…

1.2. Dụng cụ

Ống nghiệm thuỷ tinh: 12×75 mm; giá cắm ống nghiệm; khay men hình chữ nhật: 25×30 cm; bút marker; pipet nhựa; pipet tự động; đầu côn các loại; hộp đựng đầu côn; giá đỡ gelcard…

1.3. Vật tư tiêu hao

Sổ ghi kết quả; Phiếu xét nghiệm định nhóm máu; mũ giấy; khẩu trang; găng tay; quần áo công tác…

1.4. Thuốc thử và hoá chất

Tấm gelcard nước muối và tấm gelcard AHG loại IgG, dung dịch để pha hồng cầu (đệm LISS).

1.5. Mẫu máu để chọn đơn vị máu hòa hợp

– Mẫu máu người bệnh: 10 ml máu tĩnh mạch không chống đông và 2 ml máu tĩnh mạch có chống đông bằng EDTA;

– Mẫu máu của 10 đơn vị máu sẽ được chọn có cùng nhóm hệ ABO, Rh
(D) với người bệnh.

3. Thời gian làm xét nghiệm: 60 phút.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu yêu cầu lựa chọn đơn vị máu phù hợp: Kiểm tra và đối chiếu các thông tin trên mẫu máu của người bệnh với phiếu xét nghiệm yêu cầu chọn máu. Kiểm tra về số lượng và chất lượng mẫu máu của người bệnh, đơn vị túi máu. Kiểm tra mẫu máu của 10 đơn vị máu: Mẫu máu không bị đông dây, không bị vỡ hồng cầu.

3. Tiến hành xét nghiệm lựa chọn đơn vị máu phù hợp

3.1. Tiến hành chọn đơn vị máu phù hợp ở điều kiện 22°C

Bước 1: Ly tâm ống máu không chống đông của người bệnh với tốc độ 2000 vòng/phút trong vòng 3 phút để tách huyết thanh;

Bước 2: Chọn 10 đơn vị khối hồng cầu của người cho phù hợp nhóm máu hệ ABO và Rh (D) với người bệnh để tiến hành chọn máu cho người bệnh;

Bước 3: Chuẩn bị 10 ống nghiệm sạch, khô, ghi đầy đủ thông tin của từng đơn vị máu của người cho lên ống nghiệm để lấy hồng cầu từ dây túi máu của từng đơn vị túi máu;

Bước 4: Pha hồng cầu của 10 đơn vị máu 0,8% bằng cách:

– Nhỏ 1000 µl đệm LISS để pha loãng hồng cầu vào 10 ống nghiệm đã được ghi nhãn theo thứ tự từ 1 đến 10;

– Thêm 10 µl hồng cầu khối của từng đơn vị túi máu vào các ống nghiệm thích hợp đã được ghi nhãn;

– Trộn đều.

Bước 5: Ghi đầy đủ thông tin của người bệnh và các đơn vị máu của người cho lên tấm gelcard nước muối;

Bước 6: Mở tấm bảo vệ phủ lên các cột gel theo đúng quy định;

Bước 7: Nhỏ 50 µl dung dịch hồng cầu của đơn vị túi máu 0,8% đã chuẩn bị ở trên vào giếng gelcard đã ghi thông tin tương ứng với đơn vị túi máu;

Bước 8: Thêm 25 µl huyết thanh người bệnh vào các giếng gelcard trên.

Bước 9: Ủ tấm gelcard ở nhiệt độ phòng trong vòng 15 phút;

Bước 10: Ly tâm tấm glcard bằng máy ly tâm gelcard chuyên dụng trong vòng 10 phút;

Bước 11: Đọc kết quả trên máy đọc chuyên dụng và theo hướng dẫn của nhà sản xuất sinh phẩm;

Bước 12: Lưu file kết quả vào phần mềm máy tính chuyên dụng và ghi kết quả vào sổ chọn máu.

3.2. Tiến hành chọn đơn vị máu phù hợp ở điều kiện 37°C và kháng globulin người

Bước 1: Ghi đầy đủ thông tin của người bệnh và các đơn vị máu của người cho lên tấm gelcard AHG loại IgG;

Bước 2: Mở tấm bảo vệ phủ lên các cột gel theo đúng quy định;

Bước 3: Nhỏ 50 µl dung dịch hồng cầu của đơn vị túi máu 0,8% đã chuẩn bị ở trên vào giếng gelcard đã ghi thông tin tương ứng với đơn vị túi máu;

Bước 4: Thêm 25 µl huyết thanh người bệnh vào các giếng gelcard trên.

Bước 5: Ủ tấm gelcard ở 37°C trong vòng 15 phút bằng máy ủ gelcard chuyên dụng;

Bước 6: Ly tâm gelcard bằng máy ly tâm chuyên dụng trong 10 phút.

Bước 7: Đọc kết quả trên máy đọc chuyên dụng và theo hướng dẫn của nhà sản xuất sinh phẩm.

Bước 8: Lưu file kết quả vào phần mềm máy tính chuyên dụng và ghi kết quả vào số chọn máu.

VI. NHẬN ĐỊNH KẾT QUẢ

– Chọn được đơn vị máu hòa hợp: Khi kết quả phản ứng hòa hợp giữa huyết thanh người bệnh với hồng cầu của đơn vị máu âm tính ở cả 3 điều kiện, nhiệt độ (22°C, 37°C và kháng globulin người);

– Không chọn được đơn vị máu hòa hợp: Khi kết quả phản ứng hòa hợp giữa huyết thanh người bệnh với hồng cầu của đơn vị máu dương tính với cả 10 đơn vị máu được chọn ở 1 trong 3 điều kiện, 2 trong 3 điều kiện hoặc cả 3 điều kiện, nhiệt độ (22°C, 37°C và kháng globulin người).

Những điểm cần chú ý khi làm xét nghiệm:

1. Thực hiện kiểm chứng theo quy định của thông tư 26/2013/TT-BYT về “Hướng dẫn hoạt động truyền máu” [4];

2. Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm hiện đang sử dụng;

3. Cần thực hiện kỹ thuật lựa chọn đơn vị máu phù hợp sớm sau khi lấy mẫu máu xét nghiệm của người bệnh;

4. Mẫu máu sau khi thực hiện kỹ thuật chọn đơn vị máu hòa hợp phải được lưu giữ theo đúng quy định.

TÀI LIỆU THAM KHẢO

1. Bùi Thị Mai An (2010), Đặc điểm một số nhóm máu hệ hồng cầu và
mối liên quan với bệnh lý, Một số chuyên để Huyết học – Truyền máu tập 3, Nhà xuất bản Y học.

2. Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.

3. Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood Groups, Blackwell.

4. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

PHẢN ỨNG HÒA HỢP CÓ SỬ DỤNG KHÁNG GLOBULIN NGƯỜI (KỸ THUẬT ỐNG NGHIỆM)

I. NGUYÊN LÝ

Phản ứng hòa hợp có sử dụng kháng globulin người bằng kỹ thuật ống nghiệm được dựa trên nguyên lý của phản ứng ngưng kết trong môi trường 37°C và có sử dụng thuốc thử kháng globulin người (Huyết thanh Coombs) để phát hiện sự có mặt của các kháng thể đồng loài có trong huyết thanh của người bệnh mà đã được gắn lên hồng cầu của đơn vị máu [1], [2], [3].

II. CHỈ ĐỊNH

Xét nghiệm phản ứng hòa hợp có sử dụng kháng globulin người được chỉ định trong trường hợp: người bệnh được chỉ định truyền máu toàn phần, khối hồng cầu, khối bạch cầu [5].

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị:

Máy ly tâm thường có số vòng chính xác; kính hiển vi; bình cách thủy; tủ lạnh…

2.2. Dụng cụ

Ống nghiệm thuỷ tinh: 12x75mm; giá cắm ống nghiệm; khay men hình chữ nhật: 25×30 cm; cốc thuỷ tỉnh có mỏ loại 500 ml; bút maker; pipet nhựa…

2.3. Thuốc thử và hoá chất

Kháng globulin người loại IgG; hồng cầu chứng, dung dịch nước muối sinh lý 0,09%…

2.4. Mẫu máu của người bệnh

Máu tĩnh mạch của người bệnh, gồm hai ống: ống chống đông bằng EDTA: 2 ml và ống không chống đông: 5 ml;

Mẫu máu của đơn vị máu để truyền cho người bệnh.

2.5. Vật tư tiêu hao

Số phát máu và chế phẩm máu; Phiếu dự trù máu của các khoa lâm sàng; phiếu truyền máu; mũ giấy; khẩu trang; găng tay; quần áo công tác…

3. Thời gian làm xét nghiệm: 60 phút.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị đầy đủ trước khi làm xét nghiệm;

2. Nhận mẫu máu và phiếu dự trù máu của khoa lâm sàng, kiểm tra và đối chiếu các thông tin trên mẫu máu của người bệnh với phiếu dự trù máu. Kiểm tra về số lượng và chất lượng mẫu máu, mẫu máu của đơn vị máu và người bệnh phải đảm bảo không bị đông dây, không bị vỡ hồng cầu;

3. Tiến hành xét nghiệm phản ứng hòa hợp có sử dụng kháng globulin người:

Bước 1: Ly tâm ống máu không chống đông của người bệnh với tốc độ 2000 vòng/phút trong vòng 3 phút để tách huyết thanh;

Bước 2: Chọn đơn vị khối hồng cầu của người cho phù hợp nhóm máu hệ ABO và Rh (D) với người bệnh;

Bước 3: Chuẩn bị 1 ống nghiệm sạch, khô, ghi đầy đủ thông tin của đơn vị máu của người cho lên ống nghiệm để lấy hồng cầu từ dây túi máu của đơn vị túi máu;

Bước 4: Pha hồng cầu người cho 5% trong môi trường nước muối sinh lý (1 thể tích hồng cầu khối của người cho và 19 thể tích nước muối sinh lý);

Bước 5: Chuẩn bị một ống nghiệm sạch, khô, ghi nhãn với đầy đủ thông tin của người bệnh và đơn vị túi máu;

Bước 6: Nhỏ 1 thể tích hồng cầu của người cho 5% vào ống nghiệm đã được ghi nhãn ở trên;

Bước 7: Thêm 2 thể tích huyết thanh người bệnh vào ống nghiệm trên và trộn đều;

Bước 8: Ủ ống nghiệm trên ở bình cách thủy 37°C trong vòng 30 phút, nếu thêm 2 giọt đệm LISS vào ống nghiệm trước khi ủ thì thời gian ủ được rút ngắn chỉ còn 15 phút;

Bước 9: Sau khi ủ, ly tâm ống nghiệm trên với tốc độ 1000 vòng/phút trong vòng 20 giây;

Bước 10: Đọc kết quả bằng mắt thường và kính hiển vi ở điều kiện 37°C;

Bước 11: Ghi kết quả vào sổ kết quả phản ứng hòa hợp;

Bước 12: Sau khi đọc kết quả ở nhiệt độ 37°C, rửa hồng cầu trong ống nghiệm trên 3 lần bằng nước muối sinh lý, lấy kiệt dịch nổi sau mỗi lần rửa;

Bước 13: Kết thúc lần rửa cuối, nhỏ 2 giọt AHG vào ống nghiệm trên;

Bước 14: Ly tâm ống nghiệm trên với tốc độ 1000 vòng/phút trong vòng 20 giây;

Bước 15: Đọc kết quả bằng mắt thường và kính hiển vi. Đọc kết quả theo hướng dẫn của nhà sản xuất sinh phẩm;

Bước 16: Nếu kết quả âm tính thì nhỏ thêm 1 giọt hồng cầu chứng vào ống nghiệm trên (để kiểm chứng chất lượng của kháng globulin người), trộn đều, ly tâm với tốc độ 1000 vòng/phút trong vòng 20 giây. Đọc kết quả bằng mắt thường và kính hiển vi, kết quả phải dương tính với mức độ từ 1+ đến 2+, nếu kết quả âm tính, phải lặp lại xét nghiệm từ bước 1;

Bước 17: Ghi kết quả phản ứng hòa hợp có sử dụng kháng globulin người vào số phát máu và chế phẩm máu.

VI. NHẬN ĐỊNH KẾT QUẢ

– Kết quả phản ứng hòa hợp ở điều kiện kháng globulin người âm tính: Máu của người cho và người nhận hòa hợp, hoàn thiện các thủ tục, hồ sơ để phát đơn vị máu cho người bệnh;

– Kết quả phản ứng hòa hợp ở điều kiện kháng globulin người dương tính: Máu của người cho và người nhận không hòa hợp, thông báo cho bác sỹ lâm sàng, tư vấn cho bác sỹ lâm sàng chỉ định xét nghiệm lựa chọn đơn vị máu phù hợp để truyền cho người bệnh.

Những điểm cần chú ý khi làm xét nghiệm:

1. Thực hiện kiểm chứng theo quy định của thông tư 26/2013/TT-BYT về Hướng dẫn hoạt động truyền máu [4].

2. Đọc kỹ và tuân thủ đúng theo hướng dẫn của nhà sản xuất sinh phẩm;

3. Cần thực hiện kỹ thuật sớm sau khi lấy mẫu máu. Mẫu máu sau khi thực hiện kỹ thuật phải được lưu giữ theo đúng quy định tại [4].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

2. Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.

3. Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood Groups, Blackwell.

4. Thông tư 26/2013/TT- BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

PHẢN ỨNG HÒA HỢP CÓ SỬ DỤNG KHÁNG GLOBULIN NGƯỜI (KỸ THUẬT GELCARD TRÊN MÁY BÁN TỰ ĐỘNG)

I. NGUYÊN LÝ

Phản ứng hòa hợp có sử dụng kháng globulin người bằng kỹ thuật Scangel/Gelcard được dựa trên nguyên lý của phản ứng ngưng kết cột gel trong môi trường 37°C và có sử dụng thuốc thử kháng globulin người (Huyết thanh Coombs) để phát hiện sự có mặt của các kháng thể đồng loài có trong huyết thanh của người bệnh mà đã được gắn lên hồng cầu của đơn vị máu [1], [2], [3].

II. CHỈ ĐỊNH

Xét nghiệm phản ứng hòa hợp có sử dụng kháng globulin người được chỉ định trong trường hợp: người bệnh được chỉ định truyền máu toàn phần, khối hồng cầu, khối bạch cầu.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị

Máy ly tâm thường có số vòng chính xác; máy ủ, máy ly tâm, máy đọc gelcard chuyên dụng; tủ lạnh…

2.2. Dụng cụ

Ống nghiệm thuỷ tỉnh: 12x75mm; giá cắm ống nghiệm; khay men hình chữ nhật: 25×30 cm; cốc thuỷ tinh có mỏ loại 500 ml; bút maker; pipet man; đầu côn các loại…

2.3. Thuốc thử và hoá chất

Gelcard AHG loại IgG; dung dịch pha hồng cầu (Đệm LISS) để làm xét nghiệm…

2.4. Mẫu máu của người bệnh

Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml và
một ống không chống đông: 5 ml.

2.5. Vật tư tiêu hao

Số phát máu và chế phẩm máu; Phiếu dự trù máu của các khoa lâm sàng; Phiếu truyền máu; Mũ giấy; Khẩu trang; Găng tay; Quần áo công tác.

3. Thời gian làm xét nghiệm: 60 phút.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu dự trù máu của khoa lâm sàng, kiểm tra và đối chiếu các thông tin trên mẫu máu của người bệnh với phiếu dự trù máu. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xét nghiệm phản ứng hòa hợp có sử dụng kháng globulin người:

Bước 1. Ly tâm ống máu không chống đông của người bệnh với tốc độ 2000 vòng/phút trong vòng 3 phút để tách huyết thanh;

Bước 2. Pha dung dịch hồng cầu người cho 1% bằng cách:

– Chuẩn bị lống nghiệm sạch, khô, ghi nhãn: hồng cầu người cho 1%;

– Nhỏ vào ống nghiệm đã chuẩn bị ở trên 1000 µl đệm LISS;

– Thêm 10 µl hồng cầu khối của người cho vào ống nghiệm trên;

– Trộn đều.

Bước 3. Ghi đầy đủ thông tin của người bệnh lên tấm gelcard AHG loại
IgG;

Bước 4. Mở tấm bảo vệ phủ lên các cột gel theo đúng quy định;

Bước 5. Nhỏ 50 µl dung dịch hồng cầu người cho 1% đã chuẩn bị ở trên vào giếng gelcard đã được ghi thông tin của bệnh nhân;

Bước 6. Thêm 25 µl huyết thanh của người bệnh vào giếng gelcard trên;

Bước 7. Ủ tấm gelcard ở 37°C trong vòng 15 phút bằng máy ủ gelcard chuyên dụng;

Bước 8. Ly tâm tấm gelcard với tốc độ 1.000 vòng/ phút trong vòng 10 phút bằng máy ly tâm chuyên dụng;

Bước 9. Đọc kết quả theo hướng dẫn của nhà sản xuất trên máy đọc gelcard chuyên dụng.

VI. NHẬN ĐỊNH KẾT QUẢ

– Kết quả phản ứng hòa hợp ở điều kiện kháng globulin người âm tính (Huyết thanh của người bệnh không ngưng kết với hồng cầu của đơn vị máu): Máu của người cho và người nhận hòa hợp, hoàn thiện các thủ tục, hồ sơ, phát đơn vị máu để truyền cho người bệnh;

– Kết quả phản ứng hòa hợp ở điều kiện kháng globulin người dương tính (Huyết thanh của người bệnh ngưng kết với hồng cầu của đơn vị máu): Máu của người cho và người nhận không hòa hợp, thông báo cho bác sỹ lâm sàng, tư vấn cho bác sỹ lâm sàng chỉ định xét nghiệm lựa chọn đơn vị máu phù hợp để truyền cho người bệnh.

Những điểm cần chú ý khi làm xét nghiệm:

1. Thực hiện kiểm chứng theo quy định của thông tư 26/2013/TT-BYT về Hướng dẫn hoạt động truyền máu [4].

2. Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm hiện đang sử dụng;

3. Cần thực hiện kỹ thuật sớm sau khi lấy mẫu máu. Mẫu máu sau khi thực hiện kỹ thuật phải được lưu giữ theo đúng quy định [4].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

2. Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.

3. Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood Groups, Blackwell.

4. Thông tư 26/2013/TT-BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

XÁC ĐỊNH KHÁNG NGUYÊN D YẾU CỦA HỆ Rh

(Kỹ thuật Gelcard)

I. NGUYÊN LÝ

Xác định kháng nguyên D yếu của hệ Rh bằng kỹ thuật gelcard được dựa trên nguyên lý của phản ứng ngưng kết cột gel trong môi trường 37°C và có sử dụng thuốc thử kháng globulin người (Huyết thanh Coombs) để phát hiện sự có mặt của các kháng thể chống D loại IgG mà đã được gắn lên hồng cầu của người bệnh/ người hiến máu/ sản phụ [1], [2], [3].

II. CHỈ ĐỊNH

Xác định kháng nguyên D yếu của hệ nhóm máu Rh được chỉ định trong những trường hợp sau:

– Người bệnh;

– Người hiến máu;

– Sản phụ.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị

Máy ly tâm thường có số vòng chính xác; kính hiển vi; bình cách thủy; tủ lạnh…

2.2. Dụng cụ

Ống nghiệm thuỷ tỉnh: 12x75mm; giá cắm ống nghiệm; khay men hình chữ nhật: 25×30 cm; cốc thuỷ tỉnh có mỏ loại 500 ml; bút maker; pipet nhựa…

2.3. Thuốc thử và hoá chất

Thuốc thử anti-D loại IgG; tấm gelcard AHG loại IgG; dung dịch nước muối sinh lý; nước cất…

2.4. Mẫu máu để xác định kháng nguyên D yếu của hệ Rh

Gồm một ống máu tĩnh mạch đã được chống đông bằng EDTA: 2 ml.

2.5. Vật tư tiêu hao

Sổ ghi kết quả; Phiếu xét nghiệm định nhóm máu; mũ giấy; khẩu trang; găng tay; quần áo công tác…

3. Thời gian làm xét nghiệm: 60 phút

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm;

2. Nhận mẫu máu và phiếu dự trù máu của khoa lâm sàng, kiểm tra và đối chiếu các thông tin trên mẫu máu của người bệnh với phiếu yêu cầu xét nghiệm.

Kiểm tra về số lượng và chất lượng mẫu máu;

3. Tiến hành xét nghiệm xác định kháng nguyên D yếu

Bước 1: Pha dung dịch hồng cầu cần định nhóm 1%:

– Chuẩn bị 1 ống nghiệm sạch, khô, ghi nhãn;

– Nhỏ vào ống nghiệm đã chuẩn bị ở trên 1000 µl đệm LISS để pha hồng cầu làm phương pháp gelcard;

– Thêm 10 µl hồng cầu khối cần xác định kháng nguyên D yếu vào ống nghiệm trên;

– Trộn đều.

Bước 2. Ghi đầy đủ thông tin của người bệnh lên cột gel của tấm gelcard AHG loại IgG;

Bước 3. Mở tấm bảo vệ phủ lên các cột gel theo đúng quy định;

Bước 4. Nhỏ 50 µl dung dịch hồng cầu cần xác định kháng nguyên D yếu 1% đã chuẩn bị ở trên vào cột gel đã được ghi thông tin của bệnh nhân (Bước 2);

Bước 5. Thêm 25 µl kháng thể chống D loại IgG vào cột gel đã nhỏ hồng cầu ở bước 4;

Bước 6. Ủ tấm gelcard ở 37°C trong vòng 15 phút bằng máy ủ gelcard chuyên dụng;

Bước 7. Ly tâm tấm gelcard với tốc độ 1.000 vòng/ phút trong vòng 10 phút bằng máy ly tâm chuyên dụng;

Bước 8. Đọc kết quả trên máy đọc gelcard chuyên dụng và theo hướng dẫn của nhà sản xuất sinh phẩm;

Bước 9: Lưu file kết quả vào phần mềm máy tính chuyên dụng và ghi kết quả vào số định nhóm máu.

VI. NHẬN ĐỊNH KẾT QUẢ

– Nếu có phản ứng ngưng kết giữa hồng cầu của người bệnh/ người hiến máu với kháng thể chống D loại IgG: Kết luận người bệnh/ người hiến máu/ sản phụ có nhóm máu D yếu;

– Nếu không có phản ứng ngưng kết giữa hồng cầu của người bệnh/ người hiến máu với kháng thể chống D loại IgG: Kết luận người bệnh/ người hiến máu/ sản phụ có nhóm máu Rh(D) âm.

Những điểm cần chú ý khi làm xét nghiệm:

1. Thực hiện kiểm chứng theo quy định của thông tư 26/2013/TT-BYT về Hướng dẫn hoạt động truyền máu [4].

2. Đọc kỹ và tuân thủ đúng các bước tiến hành kỹ thuật theo hướng dẫn của nhà sản xuất sinh phẩm hiện đang sử dụng.

3. Cần thực hiện kỹ thuật sớm sau khi lấy mẫu máu. Mẫu máu sau khi thực hiện kỹ thuật phải được lưu giữ theo đúng quy định [4].

TÀI LIỆU THAM KHẢO

1. Denise M Harmening (1999) Modern blood banking and transfusion practices, fourth edition, Book Promotion & Service Co., LTD.

2. Đỗ Trung Phấn (2013), Kỹ thuật xét nghiệm huyết học và truyền máu ứng dụng trong lâm sàng (Tái bản lần 2), Nhà xuất bản y học năm 2013.

3. Geoff Daniels and Imelda Bromilow (2009), Essential Guide to Blood Groups, Blackwell.

4. Thông tư 26/2013/TT-BYT đã được ban hành ngày 16/9/2013 về Hướng dẫn hoạt động truyền máu.

PHẢN ỨNG HÒA HỢP TIỂU CẦU

(Kỹ thuật pha rắn)

I. NGUYÊN LÝ

Tiểu cầu của người cho được gắn vào bề mặt của giếng polystyrene microplate. Huyết thanh/ huyết tương của người bệnh được thêm vào giếng và ủ với tiểu cầu của người cho, nếu trong huyết thanh của người bệnh có kháng thể kháng tiểu cầu thì các kháng thể này sẽ gắn với tiểu cầu của người cho. Các globulin miễn dịch không gắn lên tiểu cầu có trong giếng sẽ được rửa sạch, sau đó thêm vào giếng dung dịch hồng cầu chỉ thị đã cảm nhiễm với anti-IgG. Ly tâm để các hồng cầu chỉ thị tiếp xúc được với các kháng thể kháng tiểu cầu có trong huyết thanh người bệnh đã được gắn với các tiểu cầu của người cho. Trong trường hợp người bệnh có kháng thể kháng tiểu cầu, phức hợp kháng nguyên, kháng thể kháng tiểu cầu và hồng cầu đã được gắn với anti-IgG (Hồng cầu chỉ thị) đã được hình thành ở trên sẽ ngăn cản sự di chuyển của các hồng cầu chỉ thị xuống đáy giếng khi được ly tâm, do vậy các hồng cầu chỉ thị sẽ bao phủ lên toàn bộ bề mặt giếng. Ngược lại trong trường hợp xét nghiệm âm tính, các hồng cầu chỉ thị sẽ không bị cản trở trong quá trình di chuyển, theo lực ly tâm sẽ lắng chặt xuống đáy giếng [1].

II. CHỈ ĐỊNH

  • Người bệnh có chỉ định truyền khối tiểu cầu được tách từ hệ thống máy tách tế bào tự động của một người hiến tiểu cầu;
  • Người bệnh có chỉ định truyền khối tiểu cầu pool;
  • Người bệnh truyền tiểu cầu không hiệu lực;
  • Người bệnh ghép tế bào gốc.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện:

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

  • Máy ly tâm phiến microplate 96 giếng;
  • Máy ủ khô 37°C;
  • Máy rửa bán tự động Immucor CSW 100 được thiết kế để sử dụng với Capture-P [2];
  • Pipetman; pipet nhựa; máy ly tâm ống nghiệm; đồng hồ hẹn giờ; bút marker…;
  • Tấm chiếu sáng;
  • Ống nghiệm polypropylene hoặc polyethylene.

2.2. Thuốc thử và hoá chất

  • Capture-P Test Wells ở trong túi kín;
  • Capture LISS trong lọ nhỏ giọt;
  • Capture-P Indicator Red Cells trong lọ nhỏ giọt;
  • Capture-P Positive Control Serum (Weak) trong lọ nhỏ giọt;
  • Capture-P Negative Control Serum trong lọ nhỏ giọt;
  • Dung dịch đệm phosphate, pH 6.5-7.5.

2.3. Mẫu bệnh phẩm

– 1 ống máu tĩnh mạch được chống đông bằng EDTA: 2 ml hoặc 1 ống không chống đông: 5 ml của người bệnh.

– Đơn vị tiểu cầu của người cho.

3. Thời gian làm xét nghiệm: 120 phút.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu chỉ định xét nghiệm, kiểm tra và đối chiếu các thông tin trên mẫu máu với phiếu chỉ định xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xét nghiệm

– Mang các hóa chất, sinh phẩm về nhiệt độ phòng 15 phút trước khi làm xét nghiệm;

– Chuẩn bị mẫu tiểu cầu làm xét nghiệm như sau:

+ Chuẩn bị 1 ống nghiệm polypropylene hoặc polyethylene sạch, khô, ghi mã của đơn vị khối tiểu cầu lên ống nghiệm.

+ Lấy 1 đoạn dây từ túi tiểu cầu của người hiến và cắt dây tiểu cầu vào ống nghiệm nhựa đã chuẩn bị ở trên.

– Lấy số lượng giếng Capture-P cần thiết để làm xét nghiệm từ túi bảo vệ;

– Dùng pipet nhựa hút 1-2 giọt (tương đương 50-100 µl) tiểu cầu của
người cho nhỏ vào 3 giếng đầu tiên của hàng. Một giếng là chứng dương (yếu) và giếng thứ hai là chứng âm, giếng thứ ba là giếng làm xét nghiệm hòa hợp giữa tiểu cầu của người cho và huyết thanh/ huyết tương của người bệnh;

– Ly tâm phiến với tốc độ 45-65 nhân với g (g là lực ly tâm của máy ly tâm) trong vòng 5 phút;

– Rửa tiểu cầu trong các giếng bằng máy rửa bán tự động Immucor CSW 100 để loại bỏ tiểu cầu và huyết tương thừa. Kiểm tra các giếng sau khi rửa để xem có tiểu cầu gắn trên đáy giếng không. Nếu tiểu cầu đã được cố định lên đáy giếng, đáy giếng sẽ xuất hiện một lớp tiểu cầu mỏng giống như mây và không còn có dịch thừa. Nếu còn dịch thừa ở đáy giếng thì cần rửa lại [2];

Lưu ý: Kỹ thuật rửa quá nhiều hoặc mạnh có thể đánh bật hoặc tạo ra các lỗ hổng trong các lớp tiểu cầu đã gắn;

– Thêm 2 giọt Capture LISS vào mỗi giếng ngay sau khi rửa;

Lưu ý: Các giếng sau khi rửa để lâu hơn 1 phút mà không nhỏ thêm capture LISS sẽ khô và dẫn đến phá vỡ các lớp tế bào tiểu cầu.

– Thêm 1 giọt Capture-P Positive Control Serum (Weak) vào giếng đầu tiên của hàng;

– Thêm 1 giọt Capture-P Negative Control Serum vào giếng thứ hai của hàng;

– Thêm 1 giọt huyết tương hoặc huyết thanh của người bệnh vào giếng thứ ba của hàng;

– Chạm nhẹ nhàng liên tục vào cạnh của phiến để trộn huyết thanh/ huyết tương của người bệnh với dung dịch Capture LISS;

Lưu ý: Màu tím của Capture Liss sẽ chuyển thành màu xanh da trời hoặc màu ngọc lam khi có mặt của huyết thanh/ huyết tương người bệnh;

– Ủ các phiến ở 36-38°C trong vòng 30-60 phút;

– Rửa tiểu cầu trong các giếng bằng máy rửa chuyên dụng;

– Thêm 1 giọt hồng cầu chỉ thị Capture-P vào mỗi giếng ngay sau khi rửa;

– Ly tâm phiến với tốc độ 700-900 x g (g là lực ly tâm của máy ly tâm) trong vòng 1 phút;

– Đặt phiến trên một mặt phẳng được chiếu sáng, so sánh kết quả của
giếng xét nghiệm với chứng dương, chứng âm. Xét nghiệm phản ứng hòa hợp tiểu cầu âm tính khi giếng xét nghiệm và chứng âm cho kết quả âm tính. Xét nghiệm phản ứng hòa hợp tiểu cầu dương tính khi giếng xét nghiệm và chứng dương cho kết quả dương tính.

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng ngưng kết: Các hồng cầu chỉ thị sẽ bao phủ lên toàn bộ bề mặt giếng, kết luận phản ứng hòa hợp tiểu cầu dương tính, chọn đơn vị tiểu cầu khác và làm lại phản ứng hòa hợp tiểu cầu cho người bệnh;

– Phản ứng không ngưng kết: Các hồng cầu chỉ thị lắng chặt xuống đáy giếng, kết luận phản ứng hòa hợp tiểu cầu âm tính, phát đơn vị tiểu cầu để truyền cho người bệnh.

Những điểm cần chú ý khi làm xét nghiệm:

1. Đọc kỹ các bước của quy trình hướng dẫn trước khi tiến hành kỹ thuật;

2. Tuân thủ đúng các hướng dẫn sử dụng sinh phẩm của nhà sản xuất sinh phẩm;

TÀI LIỆU THAM KHẢO

1. Capture-P – Solid Phase System for the Detection of IgG Antibodies to Platelets, Immuco Gamma.

2. Hướng dẫn sử dụng máy rửa Immucor CSW 100.

XÁC ĐỊNH KHÁNG NGUYÊN NHÓM MÁU

(Kỹ thuật sinh học phân tử)

I. NGUYÊN LÝ

Dựa trên kỹ thuật PCR-SSP (Kỹ thuật PCR với những đoạn mồi có trình tự đặc hiệu với alen): Phản ứng chuỗi polymerase (PCR) cho phép khuếch đại trình tự ADN đã được xác định, sau khi khuếch đại thành công, chuỗi AND đích được nhân lên với lượng vừa đủ.

Để có thể phân tích kết quả phản ứng PCR-SSP, nhiều phản ứng khuếch đại đã được thực hiện đồng thời. Những mẫu PCR gắn với đoạn mồi đặc hiệu sẽ được khuếch đại sau phản ứng PCR, trong khi những mẫu không gắn với đoạn mồi đặc hiệu thì sẽ không được khuếch đại sau phản ứng PCR.

Đoạn mồi cũng dùng để khuếch đại một chứng nội kiểm (một đoạn gen của hormon tăng trưởng người: HGH), nếu không có sản phẩm đặc hiệu sau phản ứng PCR, chứng dương vẫn phải cho kết quả rõ ràng.

Việc phát hiện của các sản phẩm PCR được thực hiện bằng cách đo các tín hiệu huỳnh quang và không cần điện di sản phẩm bằng gel như trong các hệ thống PCR thông thường.

II. CHỈ ĐỊNH

Xác định kháng nguyên nhóm máu, nhóm máu bằng phương pháp sinh học phân tử trong trường hợp:

– Người bệnh có kết quả nghiệm pháp Coombs trực tiếp dương tính;

– Người bệnh thalassemia mới truyền máu, truyền máu nhiều lần cần xác định các kháng nguyên nhóm máu;

– Người bệnh ghép tế bào gốc đồng loài có bất đồng các kháng nguyên nhóm máu với người cho;

– Người cho tế bào gốc để ghép cho người bệnh;

– Người bệnh có nhóm máu D yếu, D từng phần, D âm;

– Người bệnh có nhóm máu hệ ABO khó xác định bằng phương pháp
huyết thanh học.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Bác sỹ, cử nhân, kỹ thuật viên, điều dưỡng trung học.

2. Phương tiện

2.1. Trang thiết bị, dụng cụ, vật tư tiêu hao

– Hệ thống máy tự động FluoGene để xác định kháng nguyên nhóm máu;

– Máy đọc huỳnh quang FluoVista Analyzer của Đức; Phần mềm FluoGene;

– Máy ly tâm ống eppendorf;

– Máy lắc ủ nhiệt Thermomixer compact;

– Máy vortex;

– Máy OD đo nồng độ AND chuyên dụng;

– Fluo-Pad, khay nén để làm xét nghiệm PCR;

– Fluo-App, dụng cụ ấn tấm bảo vệ lên trên mặt khay PCR;

– Máy Thermal cycler;

– Tủ lạnh bảo quản sinh phẩm.

– Ống nghiệm eppendorf 1,5 ml, 2 ml;

– Pipet tự động có thể tích 1 đến 100 µl và 100 đến 1000 µl;

– Đầu côn có phin lọc; pipetman; ống nghiệm thủy tỉnh; pipet nhựa.

2.2. Thuốc thử và hoá chất

– Hóa chất – sinh phẩm để tách chiết AND: Bộ kít E.Z.N.A Blood DNA kit.

– Bộ kít để xác định kháng nguyên nhóm máu bằng phương pháp PCR- SSP: Bộ kít RBC-FluoGene ABO basic: Xác định kháng nguyên nhóm máu hệ ABO: A1, A2, B, 01, 02; Bộ kít RBC-FluoGene VERYfy: Xác định nhiều hệ nhóm máu RhD exon 1, 5, 10, psi, C, c, E, e, Cw, Kel 1, Kel 2, Jk³, Jkb, Fy³, Fyb, FyX, Fy null, M, N, S, s, Dombrock a/b; Bộ kít RBC-FluoGene D screen: Xác định kháng nguyên D (Exone 3, 5 và 10 của gen RHD).

Một bộ kít trên bao gồm:

– Ống Fluomix: Một ống sử dụng hết cho 1 xét nghiệm, trong ống gồm có: dNTPs, PCR buffer và Taq Polymerase;

– Nước cất (không có huỳnh quang);

– Miếng dán bảo vệ trong suốt;

– Phiến PCR 96 giếng (màu trắng, được dán barcode): Mỗi giếng chứa hỗn hợp oligonucleotide được chia nhỏ và đông khô cho phép khuếch đại những gen đích. Mỗi phần của hỗn hợp này bao gồm đoạn mồi và đoạn dò được gắn tín hiệu huỳnh quang khác nhau:

+ Một đầu dò đặc hiệu với alen (tín hiệu huỳnh quang 1).

+ Một đầu dò đặc hiệu HGH để khuếch đại chứng nội kiểm (tín hiệu huỳnh quang 2).

+ Có thể thêm một đầu dò đặc hiệu trong trường hợp nhiều phản ứng (tín hiệu huỳnh quang 3).

2.3. Mẫu bệnh phẩm: 2 ml máu tĩnh mạch có chống đông bằng EDTA của người bệnh.

3. Thời gian làm xét nghiệm: 24 giờ.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dụng cụ, hoá chất, sinh phẩm, trang thiết bị trước khi làm xét nghiệm.

2. Nhận mẫu máu và phiếu chỉ định xét nghiệm, kiểm tra và đối chiếu các thông tin trên mẫu máu với phiếu chỉ định xét nghiệm. Kiểm tra về số lượng và chất lượng mẫu máu.

3. Tiến hành xét nghiệm

3.1. Tách ADN từ mẫu máu toàn phần của người bệnh

– Chuẩn bị một ống eppendorf loại 1,5 ml, ghi tên người bệnh lên nắp và thân ống;

– Nhỏ vào ống eppendorf đã chuẩn bị ở trên 200 µl máu toàn phần;

– Thêm vào ống eppendorf trên 50 µl dung dịch elution buffer;

– Thêm 25 µl dung dịch OB protease solution và 250 µl dung dịch BL buffer vào ống eppendorf trên. Trộn mạnh các sinh phẩm trong ống eppendorf bằng máy máy vortex trong vòng 10 giây;

– Ủ ống nghiệm trên ở 65°C, lắc ống với tốc độ 300 vòng/ phút trong vòng 10 phút bằng máy lắc ủ nhiệt thermomixer compact;

– Thêm 260 µl cồn 96%, trộn đều trong vòng 10 giây;

– Chuẩn bị cột chiết tách ADN, ghi tên người bệnh lên nắp cột;

– Chuyển toàn bộ dịch trong ống eppendorf lên cột chiết tách ADN;

– Ly tâm cột chiết tách ADN với tốc độ 13.000 vòng/ phút trong vòng 1 phút, chuyển cột chiết tách ADN sang ống eppendorf mới loại 2 ml;
Thêm 500 µl dung dịch HCB buffer;

– Ly tâm với tốc độ 13.000 vòng/ phút trong 1 phút, loại bỏ dịch qua cột.

– Thêm 700 µl DNA wash buffer;

– Ly tâm cột chiết tách ADN với tốc độ 13.000 vòng/ phút trong vòng 1 phút, loại bỏ dịch qua cột. Chuyển cột chiết tách ADN sang ống eppendorf mới loại 2 ml;

– Ly tâm với tốc độ 14.000 vòng/ phút trong vòng 2 phút;

– Chuẩn bị một ống eppendorf mới, ghi tên người bệnh lên nắp và thành ống; Chuyển cột chiết tách ADN sang ống eppendorf mới đã chuẩn bị ở trên;

– Thêm 100 µl dung dịch elution buffer vào ống eppendorf trên, ủ ống eppendorf trên ở nhiệt độ phòng trong vòng 5 phút;

– Ly tâm ống eppendorf với tốc độ 14.000 vòng/ phút trong 1 phút;

– Dung dịch thu được là ADN.

3.2. Đo nồng độ và độ tinh sạch ADN

– Bật máy đo OD chuyên dụng;

– Chọn chương trình đo AND;

– Pha loãng ADN theo tỷ lệ 1: 20 với thể tích 100 µl;

– Chuẩn máy về blank sử dụng dung dịch nước cất;

– Nhập tỷ lệ pha loãng vào máy;

– Cho mẫu vào máy đo. Máy OD sẽ hiển thị các thông số: nồng độ của mẫu (µg/ml), tỷ lệ pha loãng, độ tỉnh sạch mẫu thông qua tỷ lệ A260/A280 (mẫu đạt tiêu chuẩn tỉnh sạch khi tỷ lệ A260/A280 ở trong giới hạn từ 1,7 đến 2);

– In kết quả sau khi kết thúc và tắt máy.

3.3. Phản ứng PCR

Phản ứng PCR đối với kít RBC-FluoGene ABO basic và RBC-FluoGene VERYfy:

– Rã đông khay PCR, dung dịch fluoMix và mẫu ADN;

– Trước khi bóc tấm bảo vệ phủ lên phiến PCR, kiểm tra về số lô và hạn sử dụng của bộ kít. Chứng âm/ chứng dương có trong giếng được đánh dấu bằng vạch màu đen;

– FluoMix là dung dịch dùng ngay và đã được chia sẵn thể tích cho một lần định nhóm trong mỗi ống. Trước khi thêm ADN, lắc đều FluoMix và nhỏ 7,5 µl vào giếng chứa chứng âm và chứng dương;

– Thêm 7,5 µl nước cất (không có huỳnh quang) vào giếng chứa chứng âm;

– Sau đó, thêm ADN pha loãng (nồng độ 1 ng/µl ± 50%) vào ống FluoMix còn lại (theo như bảng dưới đây), lắc trộn kỹ và nhỏ 15 µl vào các giếng phản ứng (giếng có màu xanh trên từng khay PCR), hoặc có thể nhỏ trực tiếp ADN vào ống FluoMix và pha loãng với nước để được thể tích cuối cùng. Lượng ADN cuối cùng và thể tích tổng cuối cùng được thể hiện trong bảng dưới đây:

Kít Thể tích dung dịch FluoMix Thể tích mẫu ADN (1ng/µl±50%)/Test Lượng ADN Tổng thể tích cuối cùng (FluoMix, H2O và ADN)
ABO basic 150 µl 150 µl 150 ng 300 µl
VERYfy 270 µl 270 µl 270 ng 540 µl

 

– Phủ phiến PCR bằng tấm bảo vệ trong suốt, tránh dấu vân tay và làm bẩn tấm bảo vệ;

– Gỗ nhẹ khay PCR để đảm bảo tất cả dung dịch rơi xuống đáy của giếng phản ứng, tránh để dung dịch bắn và dính vào tấm bảo vệ trong suốt quá trình thao tác;

– Việc đọc trước phản ứng phải được thực hiện trong vòng 15 phút sau khi thiết lập phản ứng PCR. Chuyển phiến vào máy phân tích FluoVista của hàng Inno-train và thực hiện việc đọc trước phản ứng;

– Chuyển khay PCR vào máy thermalcycler, đậy lại bằng một miếng đệm nén sạch, VD: FluoPad của inno-train và đảm bảo nắp đậy được làm nóng là sạch và khởi động chương trình PCR.

Phản ứng PCR đối với kít D-Screen

– Phiến PCR không chứa chứng âm. Nhỏ trực tiếp 7.5 µl dung dịch FluoMix và 7.5 µl nước cất vào giếng.

– Lượng ADN cuối cùng và thể tích tổng cuối cùng được thể hiện trong bảng dưới đây:

Kit Thể tích dung dịch FluoMix Thể tích mẫu ADN (1ng/µl±50%)/Test Lượng ADN Tổng thể tích cuối cùng (FluoMix, H2O và ADN)
D-Screen 9 µl 9 µl 7.5ng 15 µl

 

Chương trình PCR (sử dụng cho mọi bộ kít RBC-FluoGene)

Giai đoạn biến tính ADN khuôn 40 chu kỳ tiếp theo Giai đoạn hạ nhiệt
95°C trong 2 phút 95°C trong 15 giây

60°C trong 60 giây

20°C trong 3 phút 20°C

Tối đa 15 phút

 

3.5. Đọc huỳnh quang

Đo huỳnh quang điểm cuối thực hiện trên máy phân tích Inno-train Fluo
Vista Analyzer. Đảm bảo hơi nước không đọng trên tấm bảo vệ và việc đọc kết quả cần thực hiện trong vòng 15 phút sau chu trình nhiệt.

3.6. Tính toán số liệu

Được thực hiện tự động bằng phần mềm FluoGene.

VI. NHẬN ĐỊNH KẾT QUẢ

– Phản ứng dương tính: Có sản phẩm PCR, phát tín hiệu huỳnh quang và
được phát hiện bằng máy đọc huỳnh quang: Có kháng nguyên cần xác định trên hồng cầu;

– Phản ứng âm tính: Không có sản phẩm PCR, không phát tín hiệu huỳnh quang: Không có kháng nguyên cần xác định trên hồng cầu.

Những điểm cần chú ý khi làm xét nghiệm:

– Đọc kỹ các bước của quy trình hướng dẫn trước khi tiến hành kỹ thuật;

– Tuân thủ đúng các hướng dẫn sử dụng sinh phẩm của nhà sản xuất sinh phẩm;

TÀI LIỆU THAM KHẢO

1. Hướng dẫn sử dụng bộ kít E.Z.N.A Blood DNA kit của hãng Omega.

2. Hướng dẫn sử dụng máy OD đo nồng độ ADN của hãng Biorad.

3. Hướng dẫn sử dụng bộ kít RBC-FluoGene ABO basic của hãng Inno-Train, Đức.

4. Hướng dẫn sử dụng bộ kít RBC-FluoGene VERYfy của hãng Inno-Train, Đức.

5. Hướng dẫn sử dụng bộ kít RBC-FluoGene D screen của hãng Inno-Train, Đức.

CHƯƠNG V: KỸ THUẬT CÔNG NGHỆ TẾ BÀO GỐC

XỬ LÝ TẾ BÀO GỐC BẰNG MÁY TỰ ĐỘNG

(Automated processing of stem cells)

I. NGUYÊN LÝ

– Sử dụng các hệ thống loại máy tự động dựa trên nguyên lý ly tâm phân lớp theo tỷ trọng và cảm biến màu sắc để thu nhận lớp tế bào có nhân.

– Nguồn gốc kỹ thuật: Theo quy trình hướng dẫn của máy và AABB (American Association of Blood Bank).

II. CHỈ ĐỊNH

– Khối tế bào gốc tách từ máu ngoại vi;

– Máu dây rốn;

– Dịch hút tủy xương.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

Được đào tạo để thực hiện kỹ thuật.

2. Thiết bị-dụng cụ

2.1. Thiết bị

– Hệ thống các máy xử lý tự động Sepax, AXP…;

– Máy nối dây túi máu hoặc thiết bị kết nối vô trùng (nếu cần);

– Máy hàn dây túi máu;

– Tất cả các vật liệu phòng thí nghiệm cần thiết.

2.2. Dụng cụ – vật tư

– Túi kết quả: sử dụng một túi đông lạnh hoặc túi đảm bảo thể tích;

– 1 bộ kít thích hợp;

– Bơm tiêm dùng một lần các loại và kim 18G, 20G;

– Ống đựng mẫu xét nghiệm;

– Bông, gạc vô trùng;

– Quần áo, mũ, khẩu trang, bao chân vô trùng găng tay vô trùng.

3. Mẫu nguyên liệu

Dịch hút tủy xương, máu dây rốn, túi tế bào gốc tách từ máu ngoại vi.

V. CÁC BƯỚC TIẾN HÀNH

Quy trình này sử dụng chung cho các loại máy tự động.

1. Chuẩn bị

– Người thực hiện: rửa tay hai lần; mặc quần áo bảo hộ theo quy định;

– Chuẩn bị máy xử lý và dụng cụ;

– Chuẩn bị kít phù hợp, kiểm tra sự nguyên vẹn và hạn sử dụng.

2. Cài đặt các chỉ số và lắp đặt kít

Thực hiện theo chương trình hướng dẫn của máy:

– Bật máy;

– Cài đặt các thông số: thể tích ban đầu, sản phẩm; huyết tương bổ sung…

– Mở kít và kết nối kít với túi thu nhận và túi đầu vào (nối vô trùng);

– Lắp đặt các thành phần của kít vào các bộ phận của máy theo hướng dẫn.

3. Thực hiện chạy máy

Thao tác điều khiển máy thực hiện quy trình xử lý tự động;

Máy sẽ thực hiện các chu kỳ xử lý tự động, bao gồm:

– Hút mẫu cần xử lý vào buồng ly tâm;

– Ly tâm phân lớp;

– Xác định và thu hoạch sản phẩm qua hệ thống cảm biến, bơm và van;

– Loại bỏ thành uy trình xử lý tự động của máy.

Lặp lại chu kỳ xử lý tiếp theo đến khi xử lý hết mẫu.

Lưu ý: Theo dõi quá trình hoạt động, xử lý kịp thời các vấn đề bất thường.

4. Kết thúc quy trình xử lý

– Thực hiện các thao tác kết thúc chạy máy theo hướng dẫn;

– Tách rời và thu túi sản phẩm;

– Tháo bỏ kít và thu dọn dụng cụ;

– Hoàn thiện hồ sơ.

TÀI LIỆU THAM KHẢO

1. Solves, et al (2009). New automatic device for routine cord blood banking: Critical analysis of different volume reduction methologies. Cytotherapy, 11(8): 1101-7.

2. Lapierre et al (2007). Cord blood volume reduction using an automated system (Sepax) vs. a semi- automated system (Optipress II) and a manual method (hydoxyethyl starch sedimentation) for routine cord blood banking: a comparative study. Cytotherapy, 9(2): 165-9.

3. Philip H.Coelho, Kathy Loper (2009). Automated processing of Umbilical Cord Blood with Biosafe Sepax system and related accessories. in umbilical cord blood processing, Method 27-1; Cellular Therapy: Principle, Method and Regulation. Bethesda, MD:AABB, chapter 27, p.336-338.

4. Biosafe. Sepax cell processing system. Operator’s manual. 2012.

5. Philip H.Coelho, Kathy Loper. Automated Volume Reduction of Umbilical Cord Blood using the AutoXpress System. in umbilical cord blood processing, Method 27-2; Cellular Therapy: Principle, Method and Regulation. Bethesda, MD:AABB, 2009, chapter 27, p.338-340.

XỬ LÝ TẾ BÀO GỐC BẰNG PHƯƠNG PHÁP THỦ CÔNG

(Manual processing of stem cells)

I. NGUYÊN LÝ

– Sử dụng dung dịch HES (Hydroxy Ethyl Starch) liên kết với hồng cầu làm tăng tỷ trọng sau đó để hồng cầu tự lắng xuống dưới để lại lớp chứa nhiều tế bào có nhân bênh trên.

– Nguồn gốc kỹ thuật: theo quy trình kỹ thuật của AABB (American Association of Blood Bank) và JCBN (the Japaneses Cord Blood Bank Network).

II. CHỈ ĐỊNH

Các mẫu máu dây rốn sau thu thập.

III. CHỐNG CHỈ ĐỊNH

Khối tế bào gốc máu ngoại vi, dịch tủy xương sau thu hoạch.

IV. CHUẨN BỊ

1. Người thực hiện

Nhân viên được đào tạo để thực hiện kỹ thuật.

2. Thiết bị dụng cụ – Hóa chất

2.1. Thiết bị:

– Tủ an toàn sinh học, tủ lạnh 4°C;

– Máy ly tâm lạnh, máy lắc túi máu, máy phân tích tế bào máu; Bàn ép túi máu; máy hàn dây; kìm vuốt dây túi máu, cân điện tử.

2.2. Dụng cụ:

– Bộ túi xử lý máu dây rốn;

– Hộp đựng bông tiệt trùng, pank, kẹp dây túi máu;

– Đồng hồ bấm giây;

– Bơm và kim tiêm các loại;

– Ống đựng mẫu xét nghiệm;

Tất cả các dụng cụ phải được hấp tiệt trùng.

1.3. Hoá chất

– Dung dịch HES, DMSO, Dextran 40T.

– Dung dịch khử khuẩn (cồn 70°….);

– Chai cấy vi trùng vi nấm;

– Hóa chất tiệt trùng bàn xét nghiệm, dụng cụ.

Tất cả các môi trường hoá chất đều đã được tiệt trùng.

V. CÁC BƯỚC TIẾN HÀNH

Kỹ thuật được thực hiện trong phòng sạch đạt tiêu chuẩn B.

1. Chuẩn bị trước khi xử lý

– Người thực hiện: rửa tay hai lần; mặc quần áo bảo hộ theo quy định;

– Sát khuẩn bề mặt túi máu dây rốn trước khi chuyển vào phòng xử lý và trước khi chuyển túi vào tủ an toàn sinh học.

– Dán barcode, ghi thông tin vào phiếu và túi xử lý.
2. Thực hiện kỹ thuật

– Cắm kim lấy mẫu làm các xét nghiệm (virus và HLA…).

– Cân túi thu thập để tính thể tích trước xử lý và lượng HES sử dụng;

– Bơm dung dịch HES vào túi mẫu và trộn đều từ 5 đến 10 phút;

– Kết nối túi mẫu với bộ túi xử lý và để tự lắng 50 phút;

– Ép lấy toàn bộ lớp huyết tương và lớp buffy-coat;

– Hàn tách túi hồng cầu và cân túi huyết tương chứa buffy-coat;

– Ly tâm túi huyết tương chứa buffy-coat để loại huyết tương;

– Hàn tách túi huyết tương và cân túi sản phẩm chứa buffy-coat;

– Lấy mẫu xét nghiệm tổng phân tích tế bào máu, đếm CD34, cấy khuẩn;

– Chuẩn bị dung dịch bảo quản DMSO và Dextran theo tỷ lệ 1:1 (nồng độ DMSO là 10%, nhiệt độ 2-4°C);

– Bơm dung dịch bảo quản vào túi sản phẩn trong vòng 15phút;

– Lắc đều túi hồng cầu, huyết tương lấy mẫu lưu và làm các xét nghiệm kiểm tra: điện di, nhóm máu và công thức máu…

– Kết thúc bơm lấy trong túi sản phẩm lưu 2 tuýp và mẫu cấy vi khuẩn.

– Chuyển sản phẩm tế bào gốc sang túi lưu trữ và hàn tách các vị trí trên túi lưu giữ và trên dây;

– Cân túi sản phẩm;

– Đặt túi sản phẩm vào túi bảo vệ (overwap) hàn kín và đặt vào hộp bảo vệ kim loại (canister);

– Chuyển túi sản phẩm và mẫu đi hạ nhiệt.

3. Hoàn thiện hồ sơ và các thực hiện các xét nghiệm đánh giá

– Điền đầy đủ các thông tin trên phiếu xử lý và tính hiệu suất xử lý;

– Gửi mẫu xét nghiệm: Công thức máu, nhóm máu, virus, điện di, CD34, HLA, cấy máu đến các phòng xét nghiệm;

TÀI LIỆU THAM KHẢO

1. Dazey, Bernard; Ducher, et al (2005). Cord blood processing by using a standard manual and automatic- closed system. Stem cells and Development, Vol 14 (1).

2. Lapierre V, Pellegrini N, et al (2007). Cord blood volume reduction using an automated system (Sepax) vs. a semi- automated system (Optipress II) and a manual method (hydroxyethyl starch sedimentation) for routine cord blood banking: acomparative study. Cytotherapy; 9(5):514

3. Dragoslav Domanovic. Placental/Umbbilical cord blood collection & Processing. Blood Transfusion Centre Slovania.

4. Melissa Croskell, Kathy Loper, David H.McKenna (2009). HES sedimentation for Manual Red Cell Removal, in Basic Cellular therapy manufacturing procedures, Method 26-2; Cellular Therapy: Principle, Method and Regulation. Bethesda, MD: AABB, chapter 26, p.312-4.

ĐÔNG LẠNH KHỐI TẾ BÀO GỐC BẰNG HỆ THỐNG HẠ NHIỆT ĐỘ

(Cryopreservation of stem cell concentrate using automated freezing system)

I. NGUYÊN LÝ

– Đưa nhiệt độ khối tế bào gốc sau khi xử lý +4°C về -90°C tránh làm tổn thương và chết do sốc nhiệt trước khi lưu giữ trong nitơ lỏng.

-Nguồn gốc kỹ thuật: Theo quy trình hướng dẫn của hãng Thermogenetics và AABB (American Association of Blood Bank).

II. CHỈ ĐỊNH

Các loại tế bào gốc trước khi lưu bảo quản ở điều kiện nitơ lỏng.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên đã được đào tạo thực hiện quy trình;

– Được trang bị các dụng cụ bảo hộ chuyên dụng khi tiếp xúc với nitơ
lỏng.

2. Thiết bị, dụng cụ

– Máy hạ nhiệt độ theo chương trình có kết nối với máy tính;

– Bình cấp nitơ lỏng cho máy hạ nhiệt độ;

– Giá đỡ cat-set;

– Bộ dụng cụ bảo hộ khi tiếp xúc với nitơ lỏng.

3. Môi trường, hoá chất

– Nitơ lỏng cho hạ lạnh và lưu trữ tế bào.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị máy

– Đưa áp suất bình cấp nitơ lỏng về khoảng 20-30psi và kết nối với máy;

– Bật máy hạ nhiệt độ, khởi động phần mềm TF trên màn hình:

+ Chọn phần mềm hạ nhiệt độ khối tế bào gốc

+ Chọn chương trình hạ nhiệt độ theo loại tế bào gốc;

2. Chuyển mẫu vào buồng hạ nhiệt

– Đặt cat-set chứa mẫu tế bào gốc lên giá đỡ của buồng hạ nhiệt độ;

– Đặt đầu cảm ứng nhiệt độ của mẫu tiếp xúc với khối tế bào gốc;

– Đóng cửa của buồng hạ nhiệt độ;

– Mở van cấp nitơ vào máy hạ lạnh;

– Nhấn nút “Start” để chạy chương trình.

3. Thực hiện và theo dõi trong quá trình chạy máy

– Thực hiện chu trình hạ nhiệt theo các bước (thiết lập theo loại tế bào gốc);

– Theo dõi các bất thường trong quá trình chạy (cảnh báo bằng còi và sơ đồ hạ nhiệt được hiển thị);

– Kết thúc chạy máy nhấn nút “Stop”;

– Nhấn nút “Back” trên máy hạ nhiệt độ và khóa van cấp nitơ cho máy.

4. Chuyển mẫu lưu giữ đông lạnh

– Mở buồng hạ nhiệt độ của máy;

– Lấy cat-set chứa mẫu tế bào gốc đã đông lạnh đặt vào vị trí trên giá cài;

– Đặt giá cài cat-set vào hệ thống bình lưu trữ;

5. Hoàn thiện hồ sơ và thu dọn dụng cụ

– Lưu file và in chương trình theo dõi chạy máy;

– Thoát chương trình tắt máy và vệ máy và thu dọn dụng cụ.

TÀI LIỆU THAM KHẢO

1. Allison Hubel. Cryopreservation of cellular therapy products. Cellular Therapy: Principle, Method and Regulation. Bethesda, MD:AABB, 2009, chapter 28, p.342- 357.

2. Kelvin G.M.Brockbank, James C.Covault, Michael J.Taylor. A guide to cryopreservation techniques. Cryopreservation manual by Artisan technology group-Thermo Scientific corp, 2003.

RỬA SẢN PHẨM TẾ BÀO GỐC SAU BẢO QUẢN BẰNG MÁY TỰ ĐỘNG

(Washing cryopreserved stem cell products using automated system)

I. NGUYÊN LÝ

– Dựa trên nguyên lý ly tâm phân lớp theo tỷ trọng và cảm biến màu, hệ thống máy sẽ loại bỏ các thành phần như DMSO, huyết sắc tố và các mảnh vỡ tế bào… trong khối tế bào gốc sau bảo quản đông lạnh.

– Nguồn gốc kỹ thuật: Theo quy trình hướng dẫn của các hãng máy sử dụng và tài liệu AABB (American Association of Blood Bank).

II. CHỈ ĐỊNH

Các loại tế bào gốc vừa rã đông sau bảo quản đông lạnh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên đã được đào tạo thực hiện quy trình;

2. Thiết bị, dụng cụ

– Nguồn điện, hệ thống máy;

– Bộ kit rửa;

– Túi đựng chất thải.

3. Môi trường, hoá chất

– Dung dịch rửa sử dụng các loại: Huyết tương, albumin hoặc nước muối sin lý NaCl 0,9%;

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dung dịch rửa

Thể tích (V) dung dịch rửa được tính bằng công thức:

– V rửa = V mẫu × tỷ lệ hòa loãng + V sản phẩm + 30 (ml) (nếu rửa bằng quy trình chuẩn – standard wash)

Hoặc:

– V rửa = V mẫu × tỷ lệ hòa loãng + V sản phẩm + 250 (ml) (nếu rửa bằng quy trình high wash)

2. Chuẩn bị bộ kit và lắp vào máy

– Kiểm tra kit trước khi mở để đảm bảo sử dụng đúng loại kit

– Mở kit đóng tất cả các kẹp

– Kết nối kít với túi chứa sản phẩm trong điều kiện vô trùng.

– Kết nối kít với dung dịch rửa trong điều kiện vô trùng.

3. Cài đặt thông số và lắp vào máy

– Cài đặt các thông số cho máy: thể tích mẫu đầu vào, sản phẩm đầu ra, dung dịch rửa;

– Tiến hành lắp kit theo hướng dẫn của màn hình hoặc sơ đồ.

4. Mồi hệ thống

5. Rã đông và kết nối túi mẫu với kít

– Rã đông mẫu tế bào gốc trong bể cách thủy ở 37°C;

– Kết nối mẫu sau rã đông với kít.

6. Chạy máy tự động và theo dõi trong quá trình chạy

7. Kết thúc chạy máy

– Tháo bộ kít ra khỏi máy;

– Tách rời và thu túi sản phẩm;

– Lấy mẫu kiểm tra kết quả;

– Thu dọn dụng cụ.

Chú ý: Chất lượng của tế bào đã được rửa phải được kiểm soát, bằng quy trình được được phê duyệt trước khi truyền cho người bệnh.

TÀI LIỆU THAM KHẢO

1. Allison Hubel. Cryopreservation of cellular therapy products. Cellular Therapy

RỬA SẢN PHẨM TẾ BÀO GỐC SAU BẢO QUẢN
BẰNG PHƯƠNG PHÁP THỦ CÔNG

(Washing cryopreserved stem cell products by manual method)

I. NGUYÊN LÝ

– Dựa theo nguyên ly tâm phân lớp theo tỷ trọng và ép tách để loại bỏ các thành phần như DMSO, huyết sắc tố và các mảnh vỡ tế bào… trong khối tế bào gốc sau bảo quản đông lạnh.

– Nguồn gốc kỹ thuật: Theo tài liệu AABB (American Association of Blood Bank).

II. CHỈ ĐỊNH

Các sản phẩm tế bào gốc vừa rã đông sau bảo quản đông lạnh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

– Kỹ thuật viên đã được đào tạo thực hiện quy trình;

2. Thiết bị, dụng cụ

– Máy ly tâm;

– Bộ túi rửa chuyên dụng;

– Túi đựng chất thải.

3. Môi trường, hoá chất

Dung dịch rửa sử dụng các loại: Huyết tương, Albumin hoặc nước muối sinh lý NaCl 0,9%;

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị dung dịch rửa

Thể tích (V) dung dịch rửa được tính bằng công thức:

V rửa = V mẫu × tỷ lệ hòa loãng + V sản phẩm + 30 (ml)

2. Chuẩn bị bộ túi rửa chuyên dụng

– Kiểm tra bộ túi trước khi mở;

– Mở bộ túi và đóng tất cả các kẹp;

– Kết nối bộ túi với túi chứa sản phẩm trong điều kiện vô trùng;

– Kết nối bộ túi với dung dịch rửa trong điều kiện vô trùng;

– Kết nối bộ túi với túi chứa mẫu đầu vào.

3. Rã đông và kết nối túi mẫu với bộ túi rửa

4. Chuẩn bị và thực hiện ly tâm phân lớp

5. Thu sản phẩm

– Ép phần dung dịch trong sang túi chất thải;

– Giữ lại thể tích sản phẩm bằng thể tích ban đầu.

6. Lặp lại bước 4 và 5 nếu có chỉ định rửa lần 2

7. Kết thúc rửa

– Thu túi sản phẩm;

– Lấy mẫu xét nghiệm đánh giá kết quả;

– Thu dọn dụng cụ.

Chú ý: Chất lượng của tế bào đã được rửa phải được kiểm soát, bằng quy trình được phê duyệt trước khi truyền cho người bệnh.

TÀI LIỆU THAM KHẢO

1. Allison Hubel. Cryopreservation of cellular therapy products. Cellular Therapy

ĐÁNH GIÁ TỶ LỆ SỐNG CỦA TẾ BÀO BẰNG KỸ THUẬT
TẾ BÀO DÒNG CHẢY

(Assessment of cellular viability by flow cytometry)

I. NGUYÊN LÝ

Dựa trên nguyên lý kết hợp đặc hiệu của kháng nguyên và kháng thể, sử dùng kháng thể đơn dòng kháng CD45 và chất màu huỳnh quang để phát hiện các tế bào tạo máu. Dùng thuốc thử đặc hiệu (7-AAD) để phân biệt tế bào sống và tế bào chết (những tế bào chết sẽ bắt màu thuốc nhuộm) băng hệ thống đếm tế bào dòng chảy. Qua đó có thể tính tỷ lệ tế bào sống trên một quần thể.

Nguồn gốc quy trình: theo quy trình kỹ thuật của hãng, theo AABB (American Association of Blood Bank).

II. CHỈ ĐỊNH

Tất cả các loại mẫu tế bào tạo máu cần xác định tỷ lệ tế bào sống (tế bào gốc trước, sau xử lý, bảo quản…);

III. CHỐNG CHỈ ĐỊNH

Tế bào gốc không thuộc hệ tạo máu.

IV. THUẬT NGỮ SỬ DỤNG

– 7-AAD (7-aminoactinomycin D): có ái lực mạnh với DNA, đi vào tế bào khi màng tế bào tổn thương hay tế bào chết.

– CD45: Dấu ấn đặc hiệu của tế bào tạo máu.

V. CHUẨN BỊ

1. Người thực hiện

Cán bộ được đào tạo để thực hiện kỹ thuật.

2. Phương tiện – Hóa chất

2.1. Phương tiện

– Hệ thống Flow cytometry;

– Máy trộn mẫu vortex;

– Máy tính và phần mềm phân tích kết quả;

– Micro pipet, đầu côn, ống nghiệm;

Găng tay, mũ, khẩu trang.

2.2. Hóa chất

– Bộ kít xét nghiệm gồm kháng thể kháng CD45, 7-AAD;

– Dung dịch phá hồng cầu NH4Cl 1X;

– Dung dịch PBS 1X.

3. Mẫu bệnh phẩm

Mẫu tế bào gốc hoặc máu có chống đông EDTA.

VI. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị mẫu và hóa chất

– Chuẩn bị bộ kit xét nghiệm gồm các kháng thể kháng CD45, 7-AAD;.

– Đếm số lượng bạch cầu của mẫu;

– Dùng dung dịch PBS 1X pha loãng mẫu sao cho số lượng bạch cầu còn khoảng 10-15 G/l;

2. Ủ mẫu với kháng thể

– Hút 100µl mẫu đã pha loãng vào ống nghiệm chạy máy;

– Thêm 20µl kháng thể kháng CD45 (gắn huỳnh quang) vào ống;

– Thêm 20µl 7-AAD vào ống;

– Ủ hỗn hợp trong 20 phút, điều kiện tối, nhiệt độ phòng;

3. Phá hồng cầu

– Dùng nước cất và hóa chất Lysing 10X để pha 2ml dung dịch Lysing
1X;

– Thêm 2ml dung dịch Lysing 1X đã pha vào hỗn hợp đã ủ trong ống nghiệm;

– Tiếp tục ủ trong 10phút, điều kiện tối ở nhiệt độ phòng;

4. Chạy mẫu trên máy Flow

– Mở máy, chọn chương trình chạy phù hợp, nhập các thông số cần thiết;

– Đưa lần lượt các ống nghiệm vào đúng vị trí trong máy;

– Chạy máy.

5. Đọc kết quả

– Chọn quần thể dương tính với CD45 là quần thể tế bào tạo máu;

– Trên cửa số 7-AAD, xác định rõ quần thể tế bào âm tính với 7-AAD là quần thể tế bào sống, đọc tỷ lệ tế bào sống ở bảng kết quả.

TÀI LIỆU THAM KHẢO

1. Nicholas Greco, Lynn O’Donnell (2009). Assessing Viability by measuring apoptotic cells using flow cytometry. AABB 2009 – Cellular therapy: principles, methods and regulation; Method 47-3, p.569-72.

2. Beckmann coulter (2004). Instruction for use Cytomic FC500 with CXP software.

ĐỊNH DANH KHÁNG THỂ ANTI-HLA BẰNG KỸ THUẬT ELISA

(Anti-HLA antibodies identification by ELISA Technique)

I. NGUYÊN LÝ

Dựa trên nguyên lý kết hợp đặc hiệu giữa kháng nguyên và kháng thể, dùng kháng nguyên đã biết để tìm kháng thể chưa biết. Ủ kháng nguyên với kháng thể của người bệnh, sau đó ủ với kháng kháng thể gắn enzyme và chất màu phù hợp. Do enzyme thủy phân chất màu nên khi đọc trên máy quang phổ kế, vị trí nào có sự biến đổi chất màu thì tương ứng có phản ứng kháng nguyên kháng thể và đọc được tên kháng thể tương ứng.

Nguồn gốc quy trình: theo quy trình kỹ thuật của hãng.

II. CHỈ ĐỊNH

Người bệnh ghép tế bào gốc đồng loại, ghép cơ quan;

III. CHỐNG CHỈ ĐỊNH

Người bệnh ghép tế bào gốc tự thân.

IV. CHUẨN BỊ

1. Người thực hiện

Cán bộ được đào tạo để thực hiện kỹ thuật.

2. Phương tiện-Hóa chất

2.1. Phương tiện:

– Hệ thống ELISA;

– Máy tính và phần mềm phân tích kết quả;

– Micro pipet, đầu côn lọc, ống nghiệm 1,5 ml, hốt vô trùng;

Găng tay, mũ, khẩu trang.

2.2. Hóa chất:

– Bộ kít xét nghiệm gồm: phiến chạy mẫu gắn kháng nguyên, kháng kháng thể gắn enzyme; chất màu (enzyme A, enzyme B), dung dịch dừng phản ứng (stop reagent), huyết thanh chứng.

– Dung dịch đệm rửa (Wash buffer).

– Dung dịch pha loãng.

3. Mẫu bệnh phẩm

Mẫu máu không chống đông.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị mẫu

– Ly tâm ống mẫu 3.000v/p trong 10 phút.

– Hút 1ml huyết thanh/huyết tương vào ống eppendorf 1,5 ml.

2. Ủ mẫu với kháng nguyên

– Pha dung dịch huyết thanh chứng (10X) với dung dịch pha loãng để được dung dịch chứng 1X.

– Pha loãng 125µl huyết thanh người bệnh với 375µl dung dịch pha loãng.

– Chuyển 10µl huyết thanh người bệnh đã pha cho vào giếng chạy máy.

– Chuyển 10µl huyết thanh chứng 1X vào vị trí giếng quy định.

– Đậy nắp phiến và ủ ở 20-25°C trong 1 giờ.

3. Rửa mẫu

– Vẩy mạnh phiến để loại bỏ dịch nổi.

– Thấm dịch bằng cách úp ngược nhanh phiến vào giấy thấm.

– Thêm 15-20µl đệm rửa 1X vào mỗi giếng, xoay nhẹ; vẫy phiến, thấm dịch.

– Lặp lại bước rửa 2 lần.

4. Ủ mẫu với kháng kháng thể gắn enzyme

– Pha dung dịch kháng kháng thể gắn enzyme 100X về 1X;

– Thêm 10µl dung dịch đã pha vào mỗi giếng;

– Đậy nắp phiến và ủ ở 20-25°C trong 40 phút;

– Loại bỏ dịch nổi giống như bước rửa mẫu, rửa 4 lần.

5. Ủ mẫu với chất màu

– Pha 500µl enzyme A và 500µl enzyme B;

– Thêm 10µl chất màu vào mỗi giếng;

– Đậy nắp phiến, ủ ở nhiệt độ 37°C/10-15 phút, điều kiện tối.

– Thêm 5µl dung dịch dừng phản ứng vào mỗi giếng, đậy nắp và ủ 15 phút.

6. Chạy mẫu

– Chạy kết quả trong vòng 1 giờ với đầu đọc ELISA;

– Phân tích kết quả trên phần mềm.

7. Đọc và trả kết quả xét nghiệm

– Đọc kết quả;

– Ghi kết quả vào phiếu xét nghiệm;

– Ký duyệt và trả kết quả cho bộ phận chỉ định.

TÀI LIỆU THAM KHẢO

1. One Lambda (2013). Lambda antigen tray for ELISA.

2. Wang. G, Tarsitani. C (1998). A new micro-Elisa for anti-Class I and Class II antibody detection. Human Immunol. 59 (1): 133.

ĐỊNH DANH KHÁNG THỂ ANTI-HLA BẰNG KỸ THUẬT LUMINEX

(Anti-HLA antibodies identification by Luminex Technique)

I. NGUYÊN LÝ

Dựa trên nguyên lý kết hợp đặc hiệu giữa kháng nguyên và kháng thể, dùng kháng nguyên đã biết để tìm kháng thể chưa biết. Bộ kháng nguyên HLA đã biết được cố định trên các hạt nhựa và sẽ kết hợp với kháng thể cần tìm có trong huyết thanh của người bệnh. Sử dụng kháng kháng thể gắn màu huỳnh quang và đọc trên hệ thống Luminex để phát hiện các hạt có phản ứng kháng nguyên – kháng thể.

Nguồn gốc quy trình: theo quy trình kỹ thuật của hãng.

II. CHỈ ĐỊNH

Người bệnh ghép tế bào gốc đồng loại, ghép cơ quan;

III. CHỐNG CHỈ ĐỊNH

Người bệnh ghép tế bào gốc tự thân.

IV. CHUẨN BỊ

1. Người thực hiện

Cán bộ được đào tạo để thực hiện kỹ thuật.

2. Phương tiện – Hóa chất

2.1. Phương tiện

– Hệ thống Luminex, máy ủ nhiệt có lắc.

– Máy ly tâm lạnh, máy trộn mẫu vortex;

– Máy tính và phần mềm phân tích kết quả;

– Micro pipet, đầu côn lọc, ống nghiệm 1,5 ml, hốt vô trùng;

– Phiến 96 giếng chạy mẫu có màng lọc.

– Máy hút chân không.

Găng tay, mũ, khẩu trang.

2.2. Hóa chất

– Bộ kít xét nghiệm gồm hạt bead gắn kháng nguyên, chứng dương, chứng âm, chất màu huỳnh quang SA-PE 10X;

– Dung dịch đệm rửa (Wash buffer).

3. Mẫu bệnh phẩm

Mẫu máu không chống đông hoặc chống đông EDTA.

V. CÁC BƯỚC TIẾN HÀNH

1. Chuẩn bị mẫu

– Ly tâm ống mẫu 3.000v/p trong 10 phút.

– Hút 1ml huyết thanh/huyết tương vào ống eppendorf 1,5ml.

2. Ủ mẫu với kháng nguyên

– Làm ẩm giếng chạy mẫu bằng cách thêm 300µl nước cất vào giếng chạy mẫu, chờ 2-5 phút rồi hút sạch.

– Thêm 40µl đệm rửa vào mỗi giếng;

– Trộn ống đựng hạt bead gắn kháng nguyên, thêm 5µl hạt bead vào mỗi giếng.

– Thêm 12,5µl huyết thanh người bệnh vào mỗi giếng, thêm 12,5µl huyết thanh chứng âm, chứng dương vào 2 giếng riêng.

– Dán kín giếng, ủ mẫu trong 30 phút ở nhiệt độ phòng kèm theo lắc đều.

3. Rửa mẫu

– Thêm 100µl đệm rửa vào mỗi giếng, trộn đều.

– Hút dịch bằng máy hút chân không.

– Thêm 250µl đệm rửa vào mỗi giếng, trộn đều, hút chân không.

– Lặp lại 3 lần.

4. Ủ mẫu với dung dịch huỳnh quang

– Pha dung dịch huỳnh quang SA-PE 1X;

– Thêm 50µl dung dịch huỳnh quang đã pha vào mỗi giếng;

– Dán kín giếng, ủ mẫu trong 30 phút ở nhiệt độ phòng kèm theo lắc đều.

– Thêm 150 µl wash buffer vào mỗi giếng để chuẩn bị chạy máy.

5. Chạy mẫu trên máy Luminex

– Chuyển phiến chạy mẫu vào máy Luminex;

– Chạy máy theo chương trình thiết lập, đọc kết quả theo các tín hiệu dương.

6. Trả kết quả

– Ghi kết quả vào phiếu xét nghiệm, sổ lưu kết quả;

– Ký duyệt và trả kết quả cho bộ phận chỉ định;

TÀI LIỆU THAM KHẢO

1. Envy V.A.Billen (2008). Detection of HLA antibodies with special emphasis on the Luminex single antigen assay. HLA antinodies detection and clinical relevance. Chapter 2, p 33-50.

2. Luminex (2013). Luminex 200 system user manual.

3. Kathryn (2012). Basic Histocompatibility testing methods. Core concepts in Renal transplantation. Chapter 2, p 21-42.

CHƯƠNG VI: SINH HÓA HUYẾT HỌC

ĐỊNH LƯỢNG FREE KAPPA HUYẾT THANH

(Free kappa light chain)

I. NGUYÊN LÝ

Dựa trên nguyên lý miễn dịch. Sử dụng phương pháp miễn dịch đo độ đục có tăng cường các vi hạt latex. Chuỗi nhẹ Kappa tự do có trong mẫu huyết thanh sẽ kết hợp với các vi hạt latex đã được bao phủ trên bề mặt bởi lớp kháng kháng thể, tạo thành phức hợp ngưng kết miễn dịch. Do lượng các kháng thể là dư thừa nên phức hợp miễn dịch được hình thành là tỷ lệ thuận với nồng độ kháng nguyên (chất cần phân tích). Tiến hành xác định độ đục của phức hợp này bằng phương pháp đo quang bước sóng 600 nm. Dựa trên đường cong chuẩn để tính được nồng độ chuỗi nhẹ Kappa tự do cần phân tích trong mẫu bệnh phẩm.

II. CHỈ ĐỊNH

Chẩn đoán, theo dõi điều trị và tiên lượng bệnh đa u tủy xương, u lympho, bệnh đại phân tử Waldenstrốm, thoái hóa dạng tinh bột amyloid, bệnh lắng đọng chuỗi nhẹ và các bệnh mô liên kết như lupus ban đỏ hệ thống.

III. CHỐNG CHỈ ĐỊNH: Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một kỹ thuật viên.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích hóa sinh như: AU 400, 640, 2.700, 5.800 và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất và bảo quản QC, mẫu bệnh phẩm
  • Pipet các loại, ống sample cup;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm;
  • Nước cất 2 lần, nước muối sinh lý 0.9%;

2.2. Hóa chất

  • Thuốc thử 1 (R1): Có các kháng thể đặc hiệu bao phủ lên các vi hạt latex. Chất bảo quản: 0.05% ProClin™*, 0.1% E-amino-n-caproic acid (EACA) và 0.01% benzamidine.
  • Thuốc thử 2 (R2): Dung dịch chuẩn có nguồn gốc từ huyết thanh người có chứa kháng nguyên đa giá của chuỗi nhẹ Kappa tự do. Được đóng lọ dưới dạng dung dịch có tính ổn định cao có chứa 0.099% Natri azide, 0.1% EACA và 0.01% benzamidine có tác dụng như chất bảo quản.
  • Thuốc thử bổ sung: có chứa 0.099% sodium azide có tác dụng như chất bảo quản.

Các mẫu QC được lấy từ huyết thanh của người tự nguyện khỏe mạnh đã sàng lọc các yếu tố nguy cơ gây nhiễm HIV, viêm gan B, C,..

Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để trong ngăn đá của tủ lạnh.

2.3. Các dụng cụ tiêu hao khác

  • ống nghiệm;
  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông).
  • Tính ổn định của mẫu: Mẫu ổn định 21 ngày/ nhiệt độ 2-8oC; nếu bảo quản lâu hơn / nhiệt độ (-20oC) hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn: dựa trên chuẩn 6 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau mỗi 2 tuần.
  • Phân tích QC: ở cả 2 level. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Mẫu sau khi ly tâm cần được pha loãng với nước muối sinh lý theo tỉ lệ 1/10 hoặc 1/100 tùy theo từng người bệnh, sau đó chuyển vào khay đựng bệnh phẩm.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

Huyết thanh người bình thường: Khi phân tích mẫu huyết thanh của 282 người tự nguyện, khỏe mạnh có độ tuổi từ 20 – 90 tuổi có kết quả theo bảng sau:

Trị số trung bình (mg/L) SD Khoảng 95 % bách phân vị (mg/L)
Kappa tự do 8.36 7.3 3.3 – 19.4
Tỷ số κ/λ 0.63 0.6 0.26 – 1.65

 

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, nồng độ bilirubin > 200mg/L hoặc nồng độ triglycerid >5 mmol/L.

– Xử trí

Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên loại, lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG FREE LAMBDA HUYẾT THANH

(Free lambda light chain)

I. NGUYÊN LÝ

Dựa trên nguyên lý miễn dịch. Sử dụng phương pháp miễn dịch đo độ đục có tăng cường các vi hạt latex. Chuỗi nhẹ Lambda tự do có trong mẫu huyết thanh sẽ kết hợp với các vi hạt latex đã được bao phủ trên bề mặt bởi lớp kháng kháng thể, tạo thành phức hợp ngưng kết miễn dịch. Do lượng các kháng thể là dư thừa nên phức hợp miễn dịch được hình thành là tỷ lệ thuận với nồng độ kháng nguyên (chất cần phân tích). Tiến hành xác định độ đục của phức hợp này bằng phương pháp đo quang bước sóng 600 nm. Dựa trên đường cong chuẩn để tính được nồng độ chuỗi nhẹ Lambda tự do cần phân tích trong mẫu bệnh phẩm.

II. CHỈ ĐỊNH

Chỉ định giống như free kappa huyết thanh.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện: 01 cán bộ đại học chuyên ngành Hóa sinh, miễn dịch và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích hóa sinh như: AU 400, 640, 2.700, 5.800 và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất và bảo quản QC, mẫu bệnh phẩm
  • Pipet các loại, ống sample cup;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm;
  • Nước cất 2 lần, nước muối sinh lý 0.9%.

2.2. Hóa chất

  • Thuốc thử 1 (R1): Có các kháng thể đặc hiệu bao phủ lên các vi hạt latex. Chất bảo quản: 0.05% ProClin™, 0.1% E-amino-n-caproic acid (EACA) và 0.01% benzamidine
  • Thuốc thử 2 (R2): Dung dịch chuẩn có nguồn gốc từ huyết thanh người có chứa kháng nguyên đa giá của chuỗi nhẹ Lambda tự do. Được đóng lọ dưới dạng dung dịch có tính ổn định cao có chứa 0.099% Natri azide, 0.1% EACA và 0.01% benzamidine có tác dụng như chất bảo quản.
  • Thuốc thử bổ sung: có chứa 0.099% sodium azide có tác dụng như chất bảo quản.

Các mẫu QC được lấy từ huyết thanh của người tự nguyện khỏe mạnh đã sàng lọc các yếu tố nguy cơ gây nhiễm HIV, viêm gan B, C,..

Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để trong ngăn đá của tủ lạnh

2.3. Các dụng cụ tiêu hao khác

  • Ống nghiệm;
  • Găng tay, nước rửa tay, khăn lau tay, khẩu trang;
  • Bông, cồn sát trùng, bơm tiêm hoặc kim lây máu, dây ga rô.

3. Người bệnh

Cần giải thích mục đích của xét nghiệm để người bệnh và người nhà bệnh BN hiểu, từ đó có thể hợp tác trong quá trình lấy máu.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông).
  • Tính ổn định của mẫu: Mẫu ổn định 21 ngày/ nhiệt độ 2-8oC; nếu bảo quản lâu hơn ở nhiệt độ (-20oC) hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn: dựa trên 6 điểm với các nồng độ khác nhau
  • Phân tích QC: ở cả 2 level. Khi QC đạt mới tiến hành phân tích mẫu

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2giờ
  • Mẫu sau khi ly tâm được chuyển vào khay đựng bệnh phẩm
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích

VI. NHẬN ĐỊNH KẾT QUẢ

Huyết thanh người bình thường: Khi phân tích mẫu huyết thanh của 282 người tự nguyện, khỏe mạnh có độ tuổi từ 20 – 90 tuổi có kết quả theo bảng sau:

Trị số trung bình (mg/L) SD Khoảng 95 %
bách phân vị (mg/L)
Lambda tự do 13.43 12.4 5.71 – 26.3
Tỷ số κ/λ 0.63 0.6 0.26 – 1.65

 

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

  • Các yếu tố có thể ảnh hưởng đến kết quả khi:
  • Mẫu máu bị huyết tán, nồng độ bilirubin > 200mg/L. Triglycerid máu >5 mmol/L.
  • Xử trí: Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên loại lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG TRANSFERIN RECEPTOR HÒA TAN

(Solube transferin receptor – Thụ thể transferrin hòa tan)

I. NGUYÊN LÝ

– sTfR (soluble Transferin receptor) là thụ thể của transferin ở dạng hòa tan. sTfR là một protein dimer bao gồm hai tiểu đơn vị giống hệt nhau liên kết với nhau bởi cầu nối disulfide, nó có trọng lượng phân tử 190.000 Dalton. Xét nghiệm này thường được chỉ định trong chẩn đoán sớm và theo dõi điều trị bệnh thiếu máu do thiếu sắt.

Rceptor Transferin ở dạng hòa tan (sTfR) trong máu của người bệnh được xác định theo phương pháp miễn dịch đo độ đục.

– Kháng thể kháng sTfR trong thuốc thử kết hợp với sTfR trong mẫu thử tạo phức hợp miễn dịch kháng nguyên-kháng thể khiến dung dịch phản ứng có độ đục. Nồng độ sTfR có trong mẫu thử tỷ lệ thuận với độ đục do phức hợp miễn dịch kháng nguyên-kháng thể tạo ra.

II. CHỈ ĐỊNH

  • Trong các trường hợp thiếu máu thiếu sắt.
  • Xác định nhu cầu sắt của cơ thể ở mức độ tế bào trước khi có thiếu máu để chẩn đoán sớm thiếu máu thiếu sắt.
  • Theo dõi điều trị đáp ứng của cơ thể trong quá trình điều trị thiếu sắt…

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 cán bộ đại học, 01 kỹ thuật viên chuyên ngành hóa sinh

2. Phương tiện, hóa chất

  • Phương tiện: Máy xét nghiệm như: AU 640, AU 2700, Hitachi 904, 912, MODULAR P…
  • Hóa chất: Hóa chất xét nghiệm sTfR, chất chuẩn sTfR, chất kiểm tra chất lượng sTfR.

3. Người bệnh

Người bệnh cần được giải thích về mục đích của việc lấy máu để làm xét nghiệm.

4. Phiếu xét nghiệm

Phiếu xét nghiệm cần ghi đầy đủ thông tin về tên, tuổi, giới tính, khoa phòng, chẩn đoán của người bệnh và ghi rõ chỉ định xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Lấy 3 ml máu tĩnh mạch vào ống không có chất chống đông hay ống có chất chống đông là Heparin . Máu không vỡ hồng cầu. Bệnh phẩm ổn định 7 ngày ờ ở 2-8°C, 3 ngày ở 15°C đến 25°C, 4 tuần ở -15°C đến -25°C.
  • Sau khi lấy máu, đem ly tâm tách lấy huyết thanh hoặc huyết tương.
  • Bệnh phẩm chỉ rã đông 1 lần và phải để bệnh phẩm đạt nhiệt độ phòng trước khi phân tích. Để tránh hiện tượng bay hơi, bệnh phẩm, chất chuẩn, chất kiểm tra chất lượng nên phân tích trong vòng 2 giờ.

2. Tiến hành kỹ thuật

  • Máy phân tích cần chuẩn bị sẵn sàng để thực hiện phân tích mẫu: Máy đã được cài đặt chương trình xét nghiệm sTfR. Máy đã được chuẩn với xét nghiệm sTfR. Kết quả kiểm tra chất lượng với xét nghiệm sTfR đạt yêu cầu không nằm ngoài dải cho phép và không vi phạm luật kiểm tra chất lượng.
  • Người thực hiện phân tích mẫu nhập dữ liệu về thông tin người bệnh và chỉ định xét nghiệm vào máy phân tích hoặc hệ thống mạng (nếu có).
  • Nạp mẫu bệnh phẩm vào máy phân tích.
  • Ra lệnh cho máy thực hiện phân tích mẫu bệnh phẩm
  • Đợi máy phân tích mẫu theo protocol của máy
  • Khi có kết quả cần xem xét đánh giá kết quả sau đó in kết quả vào phiếu xét nghiệm để trả cho người bệnh.

VI. NHẬN ĐỊNH KẾT QUẢ

– Trị số bình thường:

+ Nam (18 – 60 tuổi): 2.2 – 5.0 mg/L;

+ Nữ (18 – 45 tuổi): 1.9 – 4.4 mg/L;

sTfR được xét nghiệm để chẩn đoán và theo dõi thiếu máu do thiếu sắt. Trong trạng thái bệnh lý này nồng độ sTfR trong máu tăng.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Những yếu tố gây nhiễu cho kết quả xét nghiệm. Kết quả xét nghiệm không bị ảnh hưởng bởi:

+ Huyết thanh vàng: Bilirubin <1.026 µmol/L.

+ Huyết thanh đục: Triglycerid < 1.000 mg/Dl.

+ Vỡ hồng cầu: Hb <1.000 mg/dL.

+ Yếu tố thấp < 750 IU/mL.

+ Kết quả không tuyến tính khi sTfR > 80 mg/L.

– Khắc phục: Khi máy phân tích ra nồng độ cao thì cần hòa loãng bệnh phẩm và thực hiện lại xét nghiệm sau đó nhân kết quả với độ hòa loãng (Trường hợp có hòa loãng tự động trên máy thì kết quả không cần nhân với độ hòa loãng do máy đã tự tính toán). Những trường hợp khác như: vỡ hồng cầu, huyết thanh vàng… thì phải lấy mẫu máu khác để phân tích lại.

ĐỘ BÃO HÒA TRANSFERIN

(Transferin saturation- TfS)

I. NGUYÊN LÝ

– TfS là tỉ lệ % các vị trí trên phân tử transferrin đã được gắn với sắt. TfS được tính toán gián tiếp thông qua 2 chỉ số sắt huyết thanh và TIBC theo công thức:

TfS (%) = Sắt huyết thanh x 100/ TIBC

Nguyên lý chung để tính TfS chính là nguyên lý đo UIBC và đo sắt huyết thanh.

– TfS được chỉ định trong các trường hợp cần khảo sát bilan về sắt và theo dõi điều trị cho các trường hợp thiếu máu hồng cầu nhỏ, Đánh giá khả năng mức độ rối loạn chuyển hóa sắt.

II. CHỈ ĐỊNH

  • Các trường hợp cần khảo sát bilan sắt trong cơ thể: Thiếu máu thiếu sắt, các bệnh lý có nguy cơ quá tải sắt…
  • Theo dõi quá trình điều trị thiếu máu thiếu sắt, điều trị thải sắt.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một kỹ thuật viên.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích hóa sinh như: AU 680, 640, 2.700, 5.800 và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất và bảo quản QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm;
  • Nước cất 2 lần.

2.2. Hóa chất

  • Hóa chất định lượng TIBC (theo qui trình đã viết).
  • Hóa chất định lượng sắt huyết thanh (theo qui trình đã viết).

Các mẫu QC được lấy từ huyết thanh của người tự nguyện khỏe mạnh đã sàng lọc các yếu tố nguy cơ gây nhiễm HIV, viêm gan B, C,..

Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để trong ngăn đá của tủ lạnh.

2.3. Các dụng cụ tiêu hao khác

  • ống nghiệm;
  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh hoặc huyết tương chống đông bằng lithium heparin
  • Tính ổn định của mẫu: Huyết thanh và huyết tương ổn trong 1 tuần khi bảo quản ở 2 đến 8°C và 3 tháng khi bảo quản (-20)oC.

Cần tách huyết thanh và huyết tương ngay sau khi lấy máu để tránh tình trạng tan máu vỡ hồng cầu.

Mẫu cần phải được thực hiện vào buổi sáng từ các người bệnh trong tình trạng đói, vì giá trị sắt có thể giảm xuống 30% trong suốt thời gian trong ngày.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn với UIBC và đường cong chuẩn với sắt huyết thanh: mỗi thông số dựa trên chuẩn 2 điểm với các nồng độ chuẩn khác nhau.
  • Phân tích QC của 2 thông số UIBC và sắt huyết thanh: ở cả 2 level với mỗi thông số. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Mẫu sau khi ly tâm chuyển vào khay đựng bệnh phẩm trên máy phân tích.
  • Đánh số (hoặc ID của người bệnh); chọn làm 2 test đồng thời UIBC và sắt huyết thanh. Sau đó vận hành theo chương trình đã được cài đặt trong máy, máy sẽ tự động phân tích.

2.3. Tính kết quả

Kết quả được tính theo 2 công thức: TIBC = UIBC + sắt huyết thanh

TfS(%) = Sắt huyết thanh x 100 / TIBC

VI. NHẬN ĐỊNH KẾT QUẢ

Trị số tham khảo: Giá trị bình thường ở người khỏe mạnh là 15 – 45%.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

Những yếu tố ảnh hưởng tới kết quả phân tích UIBC và sắt thì ảnh hưởng tới độ bão hòa transferrin.

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, nồng độ bilirubin > 200mg/L. Triglycerid máu >5 mmol/L.

– Xử trí: Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên loại và lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG SẮT CHƯA BÃO HÒA HUYẾT THANH

(Unsaturation Iron Binding Capacity – UIBC)

I. NGUYÊN LÝ

UIBC là lượng sắt có thể gắn thêm tối đa vào phân tử transferrin. Được định lượng theo phương pháp đo quang so màu bằng: Cho thuốc thử trong đó có chứa một lượng sắt cao đã biết trước nồng độ vào mẫu huyết thanh cần định lượng. Khi đó, sắt trong thuốc thử sẽ gắn thêm tối đa lên phân tử transferrin cho đến khi phân tử transferrin đã bão hòa hết. Đo lại lượng sắt còn dư trong mẫu phản ứng, từ đó tính được lượng sắt đã tham gia phản ứng gắn trên phân tử transferrin. Lượng sắt tính được chính là lượng sắt chưa bão hòa huyết thanh.

UIBC được chỉ định trong các trường hợp cần khảo sát bilan về sắt và theo dõi điều trị cho các trường hợp thiếu máu hồng cầu nhỏ.

II. CHỈ ĐỊNH

  • Giống như chỉ định độ bão hòa transferrin huyết thanh
  • Phối hợp với transferrin receptor hòa tan để chẩn đoán sớm thiếu sắt

III. CHỐNG CHỈ ĐỊNH: Không có chống chỉ định

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích hóa sinh như: AU 680, 640, 2.700, 5.800 và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất và bảo quản QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm;
  • Nước cất 2 lần.

2.2. Hóa chất

  • Thuốc thử 1 (R1): Rất độc, chứa thiourea 175mmol/L, Tris Buffer (pH 8.1) 180 mmol/L.
  • Thuốc thử 1a (R1a): Gây dị ứng, chứa clorua hydroxylammonium 36 mmol/L.
  • Thuốc thử 2 (R2): Chứa clorua hydroxylammonium, Nitroso-PSAP 176 Iimol/L.
  • Thuốc thử 2a (R2a): Iron 6.9 Iimol/L.

2.3. Chuẩn bị hóa chất

  • R1: toàn bộ thuốc thử R1a phải được chuyển vào thuốc thử R1. Trộn đều bằng cách đảo ngược nhẹ nhàng trước khi đặt trên khay hóa chất của máy.
  • R2: Toàn bộ thuốc thử R2a phải được chuyển vào lọ thuốc thử R2. Trộn đều bằng cách đảo ngược nhẹ nhàng trước khi đặt trên khay hóa chất .

Các mẫu QC được lấy từ huyết thanh của người tự nguyện khỏe mạnh đã sàng lọc các yếu tố nguy cơ gây nhiễm HIV, viêm gan B, C,..

Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để trong ngăn đá của tủ lạnh

2.3. Các dụng cụ tiêu hao khác

  • ống nghiệm;
  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh hoặc huyết tương chống đông bằng lithium heparin.
  • Tính ổn định của mẫu: Huyết thanh và huyết tương ổn trong 1 tuần khi bảo quản ở 2 đến 8°C và 3 tháng khi bảo quản (-20)oC.

Cần tách huyết thanh và huyết tương ngay sau khi lấy máu để tránh tình trạng tan máu vỡ hồng cầu.

Mẫu cần phải được thực hiện vào buổi sáng từ các người bệnh trong tình trạng đói, vì giá trị sắt có thể giảm xuống 30% trong suốt thời gian trong ngày.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn: dựa trên chuẩn 2 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau mỗi 2 tuần.
  • Phân tích QC: ở cả 2 level. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2h.
  • Mẫu sau khi ly tâm chuyển vào khay đựng bệnh phẩm trên máy phân tích.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

VII. NHẬN ĐỊNH KẾT QUẢ

Trị số tham khảo: Giá trị bình thường ở người khỏe mạnh là 21 – 84µmol/L.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, nồng độ bilirubin > 200mg/L. Triglycerid máu >5 mmol/L

– Xử trí: Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên loại lấy mẫu máu khác thay thế.

ĐO KHẢ NĂNG GẮN SẮT TOÀN THỂ

(Total Iron Binding Capacity – TIBC)

I. NGUYÊN LÝ

  • TIBC là tổng lượng sắt có thể được gắn tối đa trên phân tử transferrin của người bệnh. TIBC được tính toán gián tiếp theo công thức: TIBC = UIBC + sắt huyết thanh.
  • Nguyên lý chung để đo TIBC chính là nguyên lý đo UIBC và đo sắt huyết thanh.
  • TIBC được chỉ định trong các trường hợp cần khảo sát bilan về sắt và theo dõi điều trị cho các trường hợp thiếu máu hồng cầu nhỏ, Đánh giá khả năng đáp ứng của cơ thể với các tình trạng rối loạn chuyển hóa sắt.

II. CHỈ ĐỊNH

  • Giống như chỉ định UIBC;
  • Đánh giá khả năng vận chuyển sắt của cơ thể.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích hóa sinh như: AU 680, 640, 2700, 5800 và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất và bảo quản QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm;
  • Nước cất 2 lần.

2.2. Hóa chất

  • Hóa chất định lượng UIBC (theo qui trình đã viết);
  • Hóa chất định lượng sắt huyết thanh (theo qui trình đã viết);
  • Các mẫu QC được lấy từ huyết thanh của người tự nguyện khỏe mạnh đã sàng lọc các yếu tố nguy cơ gây nhiễm HIV, viêm gan B, C,..
  • Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để trong ngăn đá của tủ lạnh.

2.3. Các dụng cụ tiêu hao khác

  • ống nghiệm;
  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.

Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh hoặc huyết tương chống đông bằng lithium heparin.
  • Tính ổn định của mẫu: Huyết thanh và huyết tương ổn trong 1 tuần khi bảo quản ở 2 đến 8°C và 3 tháng khi bảo quản (-20)oC.

Cần tách huyết thanh và huyết tương ngay sau khi lấy máu để tránh tình trạng tan máu vỡ hồng cầu.

Mẫu cần phải được thực hiện vào buổi sáng từ các người bệnh trong tình trạng đói, vì giá trị sắt có thể giảm xuống 30% trong suốt thời gian trong ngày.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn với UIBC và đường cong chuẩn với sắt huyết thanh: mỗi thông số dựa trên chuẩn 2 điểm với các nồng độ chuẩn khác nhau.
  • Phân tích QC của 2 thông số UIBC và sắt huyết thanh: ở cả 2 level với mỗi thông số. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2h.
  • Mẫu sau khi ly tâm chuyển vào khay đựng bệnh phẩm trên máy phân tích.
  • Đánh số (hoặc ID của người bệnh); chọn làm 2 test đồng thời UIBC và sắt huyết thanh. Sau đó vận hành theo chương trình đã được cài đặt trong máy, máy sẽ tự động phân tích.

2.3. Tính kết quả

Kết quả được tính theo công thức: TIBC = UIBC + sắt huyết thanh

VI. NHẬN ĐỊNH KẾT QUẢ

Trị số tham khảo: Giá trị bình thường ở người khỏe mạnh là 28 – 110µmol/L.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, nồng độ bilirubin > 200mg/L. Triglycerid máu >5 mmol/L.

– Xử trí: Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên loại lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG VITAMIN B12 HOẠT TÍNH

(VitaminB12 Active)

I. NGUYÊN LÝ

Một xét nghiệm miễn dịch 2 bước, hoàn toàn tự động, sử dụng công nghệ hoá phát quang. Xét nghiệm sử dụng kháng thể đặc hiệu kháng- transcobalamin được đánh dấu với acridinium ester (cơ chất phát quang) trong hoá chất Lite. Hoá chất pha rắn (solid phase) gồm kháng thể đặc hiệu kháng-holotranscobalamin và được biotin hoá, gắn với hạt latex nhiễm từ được phủ streptavidin thông quan liên kết ái lực biotin-streptavidin.

Đầu tiên, mẫu được ủ với pha rắn trong 7,5 phút ở 37°C, cho phép holoTC trong mẫu gắn với kháng thể đặc hiệu kháng holotranscobalamin. Rửa cóng phản ứng.

Sau đó, thêm hoá chất Lite vào cóng phản ứng, ủ 20 phút ở 37°C. Rửa cóng phản ứng.

Cuối cùng, thêm vào acid và base để kích hoạt phản ứng phát quang. Cường độ tín hiệu ánh sáng phát ra có thể đo được bằng bộ phận nhận quang. Kết quả được tính toán dựa vào đường cong chuẩn thu được bằng cách chuẩn 2 điểm và đường cong gốc được cung cấp từ nhà sản xuất. Nồng độ chất cần định lượng tỉ lệ thuận với cường độ ánh sáng thu được.

II. CHỈ ĐỊNH

Được sử dụng trong chẩn đoán và theo dõi điều trị thiếu vitamin B12. Vitamin B12 hoạt tính (holoTC) được sử dụng trong chẩn đoán thiếu hụt Vitamin B12 từ rất sớm ở những đối tượng có nguy cơ (trước khi có thiếu máu và các triệu chứng lâm sàng khác), đặc biệt theo dõi đáp ứng với điều trị thiếu Vitamin B12.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một kỹ thuật viên.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích miễn dịch như: ADVIA Centaur CP, ADVIA Centaur XP, ADVIA Centaur XPT và một số máy khác;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.2. Hoá chất

  • Hoá chất Lite: đóng gói 5.0 mL, chứa kháng thể đơn dòng kháng transcobalamin, được đánh dấu với acridinium ester trong dung dịch đệm với chất hoạt động bề mặt và chất bảo quản.
  • Hoá chất pha rắn: đóng gói 15.0 mL, chứa kháng thể đặc hiệu kháng-holotranscobalamin và được biotin hoá, gắn với hạt latex nhiễm từ được phủ streptavidin thông quan liên kết ái lực biotin-streptavidin, trong dung dịch đệm với chất bảo quản.
  • Chất hiệu chuẩn: 2 mức nồng độ (thấp & cao), 2.0 mL/lọ, chứa holotranscobalamin tái tổ hợp, albumin huyết thanh bê và sodium azide (<0.1%)
  • QC: 2 mức nồng độ (thấp & cao), 7.0 mL/lọ, chứa holotranscobalamin tái tổ hợp, albumin huyết thanh bê, dung dịch đệm và sodium azide (<0.1%).
  • Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để hóa chất trong ngăn đá tủ lạnh.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông).
  • Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

Dựng đường chuẩn: dựa trên chuẩn 2 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 40 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.

Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.

Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

Kết quả đạt được trên 241 người khoẻ mạnh, trong đấy nam giới gồm 103 người, nữ giới gồm 138 người. Nhóm tuổi dao động từ 21-67 tuổi. Giá trị trung bình của holoTC của nhóm được thiết lập tại 81.91 pmol/L với khoảng tham chiếu từ 28.96 – 168.90 pmol/L dựa theo quy trình EP28-A3c.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

+ Mẫu máu bị huyết tán (nồng độ hemoglobin > 500 mg/dL);

+ Mẫu vàng da (nồng độ bilirubin liên hợp > 40 mg/dL, nồng độ bilirubin không liên hợp > 60 mg/dL);

+ Mẫu bị mỡ máu cao (nồng độ lipid > 1.000 mg/dL);

+ Biotin (> 100 mg/dL), Protein toàn phần (> 12 g/dL), RF (> 200 IU/mL), IgG người (> 12 g/dL), Cholesterol (> 500 mg/dL), Methotrexate (> 91 mg/dL), Perimethamine (> 75 Lg/mL).

– Xử trí:

+ Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG THYMIDINE KINASE (TK)

I. NGUYÊN LÝ

Xét nghiệm LIAISON® Thymidine Kinase là một xét nghiệm miễn dịch hóa phát quang cạnh tranh hai bước gián tiếp để định lượng TK trong huyết thanh và huyết tương EDTA. Xét nghiệm được sử dụng phản ứng enzyme ban đầu trong đó TK trong mẫu chuyển đổi AZT (3′-azido-3′- deoxythymidine) thành AZTMP (3′-azido-3′-deoxythymidine mono phosphate), xét nghiệm này tuân theo xét nghiệm miễn dịch cạnh tranh cho phản ứng định lượng AZTMP. Lượng AZT được chuyển đổi thành AZTMP sẽ giúp định lượng được lượng TK có mặt trong mẫu. Trong xét nghiệm này, 50 µL mẫu được ủ với 100 µL dung dịch đệm 1, 20 µL dung dịch đệm 2, và 20 µL dung dịch có chứa hạt từ phủ kháng thể đa dòng kháng AZTMP. Kháng thể IgG thỏ kháng dê, sau đó kháng thể đa dòng dê kháng AZTMP được phủ lên pha rắn. Quá trình này được ủ trong 40 phút và sau đó 100µL chất đánh dấu được thêm vào, AZTMP gắn với dẫn xuất isoluminol được thêm vào. Trong suốt lần ủ đầu tiên, AZTMP kết hợp pha rắn. Sau 20 phút ủ, những nguyên liệu không liên kết được loại bỏ trong chu trình rửa. Cơ chất được thêm vào và phản ứng hóa phát quang được bắt đầu. Tín hiệu ánh sáng được đo bởi bộ phận nhân quang dưới dạng đơn vị quan hệ ánh sáng (RLU) và tỷ lệ nghịch với nồng độ TK có mặt trong chất chuẩn, chất kiểm chuẩn và trong mẫu.

II. CHỈ ĐỊNH

Định lượng Thymidine Kinase trong huyết thanh rất cần thiết cho tiên lượng và theo dõi điều trị ở người bệnh bệnh máu ác tính.

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

  • Các máy phân tích miễn dịch như: LIAISON và LIAISON XL;
  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.2. Hoá chất

  • Pha rắn – hạt từ (2.4 mL): Hạt từ phủ kháng thể thỏ và dê, dung dịch đệm, BSA 0.1%, Natri Azide 0.09%, pH 7.4.
  • Kháng thể liên hợp (12 mL): Dẫn xuất isoluminol trong dung dịch đệm, 0.2% BSA, 0.09% NaN3, pH 7.4.
  • Dung dịch đệm 1 (12 mL): Dung dịch đệm, pH 7.4 với cofactor và kháng thể IgG của thỏ và dê, 0.1% ProClin 300.
  • Dung dịch đệm 2 (1.2 mL): Dung dịch đệm, pH 4.5.
  • Chất chuẩn 1 (bột đông khô): Huyết thanh người, NaN3 0.09% và TK. Hoàn nguyên trong 1 mL nước cất hoặc nước đã loại ion. Hút và bảo quản dung dịch chất chuẩn ở -20oC.
  • Chất chuẩn 2 (bột đông khô): Huyết thanh người, NaN3 0.09% và TK. Hoàn nguyên trong 1 mL nước cất hoặc nước đã loại ion. Hút và bảo quản dung dịch chất chuẩn ở -20oC.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay;
  • Bông , cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu: Dùng mẫu huyết thanh hoặc huyết tương EDTA.
  • Tính ổn định của mẫu: Mẫu có thể ổn định trong vòng 48h ở 2-8oC, hoặc bảo quản ở (-20oC hoặc thấp hơn) trong 3 tháng. Mẫu cần được rã đông và trộn đều trước khi xét nghiệm. Tránh rã đông nhiều lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

  • Dựng đường chuẩn: dựa trên chuẩn 2 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 14 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.
  • Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

VI. NHẬN ĐỊNH KẾT QUẢ

Mẫu huyết thanh từ 98 người bệnh có sức khỏe tốt được lặp lại xét nghiệm 2 lần với xét nghiệm LIAISON Thymidine Kinase

Quần thể (n) Giá trị TK trung bình Dải tham chiếu (95%)
Người khỏe mạnh (n=98) 4.3 U/L 2.0 – 7.5 U/L

 

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Các xét nghiệm được thực hiện không bị ảnh hưởng bởi cholesterol (tối đa 500 mg/dL), mẫu tán huyết (tối đa 500 mg/dL), bilirubin (tối đa 20 mg/dL), và triglyceride (tối đa 3.000 mg/dL).

– Xử trí: Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế.

ĐỊNH LƯỢNG IgA KAPPA

I. NGUYÊN LÝ

Dựa trên nguyên lý đo độ đục miễn dịch do sự kết hợp giữa kháng nguyên hoà tan (IgA Kappa) và kháng thể đặc hiệu với IgA Kappa. Khi phản ứng kết hợp miễn dịch xảy ra sẽ tạo ra phức hợp miễn dịch có độ đục đo được bằng quang học qua cuvette đo với nguốn sáng của thiết bị.

Với việc đo độ đục các chất chuẩn (Calibrator) biết trước nồng độ, thiết bị đo sẽ thiết lập được đường cong chuẩn để dựa vào đường cong chuẩn nay khi đo độ đục của mẫu thử IgA Kappa chưa biết nồng độ trong huyết thanh của người bệnh thì sẽ tính được nồng độ của IgA Kappa trong mẫu huyết thanh của người bệnh này.

II. CHỈ ĐỊNH

Theo dõi điều trị bệnh lý đa u tuỷ xương (multiple myeloma).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

Máy xét nghiệm miễn dịch độ đục SPAPLUS hãng Binding Site (Anh)

  • Máy ly tâm
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm
  • Pipet các loại, ống sample cup, sample tuýp
  • Ống nghiệm, đầu côn xanh và vàng
  • Giá đựng ống nghiệm

2.2. Hoá chất

Kít hoá chất đầy đủ gồm :

+ Antiserum: Human IgA Kappa đủ cho 50 test. Chứa kháng thể đa dòng đơn đặc hiệu chiết xuất từ cừu và chất bảo quản: 0.099% sodium azide, 0.1% E-amino-n-caproic acid (EACA), 0.01% benzamidine và 1mM ethylenediaminetetraacetic acid (EDTA).

+ Dung dịch đệm (Reaction buffer) cho phản ứng đủ cho 50 test. Chứa chất bảo quản có thành phần 0.099% sodium azide.

+ Chất hiệu chuẩn: 6 mức nồng độ từ hấp đến cao (6×1,0 mL/lọ). Chứa huyết thanh hỗn hợp của người bình thường và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

+ QC: 2 mức nồng độ (thấp & cao), (2×1.0 mL/lọ). Chứa huyết thanh hỗn hợp của người và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

– Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để hóa chất trong ngăn đá tủ lạnh. Antiserum, đệm, Chất hiệu chuẩn và QC có thể để 3 tháng sau khi mở nắp trong tủ lạnh ở nhiệt độ 2-8oC hay 28 ngày trên máy SPAPLUS với điều kiện duy trì chạy máy liên tục.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay.
  • Bông, cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông)
  • Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

– Dựng đường chuẩn: dựa trên chuẩn 6 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 40 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.

– Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

2.3. Dải đo được: 0.18 – 11.2 g/L. Khi vượt ngưỡng đo trên phải tiến hành pha loãng bệnh phẩm.

VI. NHẬN ĐỊNH KẾT QUẢ

Người bình thường có IgA Kappa trong dải 0.57-2.08 g/L, IgA Lambda trong dải : 0.44-2.04 g/L vả tỷ lệ IgA Kappa/ IgA Lambda từ 0.78-1.94.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, mỡ máu cao, huyết thanh đục ở mức nhìn thấy được.

– Xử trí:

Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế. Khi huyết thanh đục phải ly tâm trước khi tiến hành xét nghiệm.

ĐỊNH LƯỢNG IgA LAMBDA

I. NGUYÊN LÝ

Dựa trên nguyên lý đo độ đục miễn dịch do sự kết hợp giữa kháng nguyên hoà tan (IgA Lambda) và kháng thể đặc hiệu với IgA Lambda. Khi phản ứng kết hợp miễn dịch xảy ra sẽ tạo ra phức hợp miễn dịch có độ đục đo được bằng quang học qua cuvette đo với nguốn sáng của thiết bị.

Với việc đo độ đục các chất chuẩn (Calibrator) biết trước nồng độ, thiết bị đo sẽ thiết lập được đường cong chuẩn để dựa vào đường cong chuẩn nay khi đo độ đục của mẫu thử IgA Lambda chưa biết nồng độ trong huyết thanh của người bệnh thì sẽ tính được nồng độ của IgA Lambda trong mẫu huyết thanh của người bệnh này.

II. CHỈ ĐỊNH

Theo dõi điều trị bệnh lý đa u tuỷ xương (multiple myeloma).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

IV. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

Máy xét nghiệm miễn dịch độ đục SPAPLUS hãng Binding Site (Anh)

  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.2. Hoá chất

Kít hoá chất đầy đủ gồm :

+ Antiserum: Human IgA Lambda đủ cho 50 test. Chứa kháng thể đa dòng đơn đặc hiệu chiết xuất từ cừu và chất bảo quản: 0.099% sodium azide, 0.1% E-amino-n-caproic acid (EACA), 0.01% benzamidine và 1mM ethylenediaminetetraacetic acid (EDTA).

+ Dung dịch đệm (Reaction buffer) cho phản ứng đủ cho 50 test. Chứa chất bảo quản có thành phần 0.099% sodium azide.

+ Chất hiệu chuẩn: 6 mức nồng độ từ hấp đến cao (6×1,0 mL/lọ). Chứa huyết thanh hỗn hợp của người bình thường và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine..

+ QC: 2 mức nồng độ (thấp & cao), (2×1.0 mL/lọ). Chứa huyết thanh hỗn hợp của người và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

– Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8oC. Không được để hóa chất trong ngăn đá tủ lạnh. Antiserum, đệm, Chất hiệu chuẩn và QC có thể để 3 tháng sau khi mở nắp trong tủ lạnh ở nhiệt độ 2-8oC hay 28 ngày trên máy SPAPLUS với điều kiện duy trì chạy máy liên tục.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay.
  • Bông, cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông).
  • Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

Dựng đường chuẩn: dựa trên chuẩn 6 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 40 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.

Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

2.3. Dải đo được: 0.16 -10.4g/L. Khi vượt ngưỡng đo trên phải tiến hành pha loãng bệnh phẩm.

VI. NHẬN ĐỊNH KẾT QUẢ

Người bình thường có IgA Kappa trong dải 0.57-2.08 g/L, IgA Lambda trong dải : 0.44-2.04 g/L vả tỷ lệ IgA Kappa/ IgA Lambda từ 0.78-1.94.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, mỡ máu cao, huyết thanh đục ở mức nhìn thấy được.

– Xử trí:

Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế. Khi huyết thanh đục phải ly tâm trước khi tiến hành xét nghiệm.

ĐỊNH LƯỢNG IgG KAPPA

I. NGUYÊN LÝ

Dựa trên nguyên lý đo độ đục miễn dịch do sự kết hợp giữa kháng nguyên hoà tan (IgG Kappa) và kháng thể đặc hiệu với IgG Kappa. Khi phản ứng kết hợp miễn dịch xảy ra sẽ tạo ra phức hợp miễn dịch có độ đục đo được bằng quang học qua cuvette đo với nguốn sáng của thiết bị.

Với việc đo độ đục các chất chuẩn (Calibrator) biết trước nồng độ, thiết bị đo sẽ thiết lập được đường cong chuẩn để dựa vào đường cong chuẩn nay khi đo độ đục của mẫu thử IgG Kappa chưa biết nồng độ trong huyết thanh của người bệnh thì sẽ tính được nồng độ của IgG Kappa trong mẫu huyết thanh cuả người bệnh này.

II. CHỈ ĐỊNH

Theo dõi điều trị bệnh lý đa u tuỷ xương (multiple myeloma).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

VI. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

Máy xét nghiệm miễn dịch độ đục SPAPLUS hãng Binding Site (Anh)

  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.4. Hoá chất

Kít hoá chất đầy đủ gồm :

+ Antiserum: Human IgG kappa đủ cho 50 test. Chứa kháng thể đa dòng đơn đặc hiệu chiết xuất từ cừu và chất bảo quản: 0.099% sodium azide, 0.1% E-amino-n-caproic acid (EACA), 0.01% benza1idine và 11M ethylenediaminetetraacetic acid (EDTA).

+ Dung dịch đệm (Reaction buffer) cho phản ứng đủ cho 50 test. Chứa chất bảo quản có thành phần 0.099% sodiu1 azide.

+ Chất hiệu chuẩn: 6 mức nồng độ từ hấp đến cao ( 6×1,0 11/lọ). Chứa huyết thanh hỗn hợp của người bình thường và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

+ QC: 2 mức nồng độ (thấp & cao), (2×1.0 mL/lọ). Chứa huyết thanh hỗn hợp của người và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

– Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8°C. Không được để hóa chất trong ngăn đá tủ lạnh. Antiseru1, đệm, Chất hiệu chuẩn và QC có thể để 3 tháng sau khi mở nắp trong tủ lạnh ở nhiệt độ 2-8°C hay 1 tháng trên máy SPA Plus với điều kiện duy trì chạy 1áy liên tục.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay.
  • Bông, cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

  • Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông)
  • Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

Dựng đường chuẩn: dựa trên chuẩn 6 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 40 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.

– Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

  • Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.
  • Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

2.3. Dải đo được: 1,9 -40,0 g/L. Khi vượt ngưỡng đo trên phải tiến hành pha loãng bệnh phẩm.

VI. NHẬN ĐỊNH KẾT QUẢ

Người bình thường trong IgG Kappa trong dải 3,84-12,07 g/L, IgG Lambda trong dải : 1,91-6,74 g/L vả Tỷ lệ IgG kappa/ IgG Lambda từ 1,12-3,12.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, mỡ máu cao, huyết thanh đục ở mức nhìn thấy được.

– Xử trí:

Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế. Khi huyết thanh đục phải ly tâm trước khi tiến hành xét nghiệm.

ĐỊNH LƯỢNG IgG LAMBDA

I. NGUYÊN LÝ

Dựa trên nguyên lý đo độ đục miễn dịch do sự kết hợp giữa kháng nguyên hoà tan (IgG Lambda) và kháng thể đặc hiệu với IgG Lambda. Khi phản ứng kết hợp miễn dịch xảy ra sẽ tạo ra phức hợp miễn dịch có độ đục đo được bằng quang học qua cuvette đo với nguốn sáng của thiết bị.

Với việc đo độ đục các chất chuẩn (Calibrator) biết trước nồng độ, thiết bị đo sẽ thiết lập được đường cong chuẩn để dựa vào đường cong chuẩn nay khi đo độ đục của mẫu thử IgG Lambda chưa biết nồng độ trong huyết thanh của người bệnh thì sẽ tính được nồng độ của IgG Lambda trong mẫu huyết thanh của người bệnh này.

II. CHỈ ĐỊNH

Theo dõi điều trị bệnh lý đa u tuỷ xương (multiple myeloma).

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

VI. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

Máy xét nghiệm miễn dịch độ đục SPAPLUS hãng Binding Site (Anh)

  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.2. Hoá chất

Kít hoá chất đầy đủ gồm :

+ Antiserum: Human IgG Lambda đủ cho 50 test. Chứa kháng thể đa dòng đơn đặc hiệu chiết xuất từ cừu và chất bảo quản: 0.099% sodium azide, 0.1% E-amino-n-caproic acid (EACA), 0.01% benzamidine và 1mM ethylenediaminetetraacetic acid (EDTA).

+ Dung dịch đệm (Reaction buffer) cho phản ứng đủ cho 50 test. Chứa chất bảo quản có thành phần 0.099% sodium azide.

+ Chất hiệu chuẩn: 6 mức nồng độ từ hấp đến cao (6×1,0 mL/lọ). Chứa huyết thanh hỗn hợp của người bình thường và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine

+ QC: 2 mức nồng độ (thấp & cao), (2×1.0 mL/lọ). Chứa huyết thanh hỗn hợp của người và chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

– Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8°C. Không được để hóa chất trong ngăn đá tủ lạnh. Antiserum, đệm, Chất chuẩn và QC có thể để 3 tháng sau khi mở nắp trong tủ lạnh ở nhiệt độ 2-8oC hay 1 tháng trên máy SPAPLUS với điều kiện duy trì chạy máy liên tục.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay
  • Bông, cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

  • Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.
  • Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

– Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông)

– Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

– Dựng đường chuẩn: dựa trên chuẩn 6 điểm với các nồng độ chuẩn khác nhau. Dựng lại đường cong chuẩn sau 40 ngày. Ngoài ra, cần phải hiệu chuẩn lại trong các trường hợp sau: thay đổi số lot hoá chất, thay thế các bộ phận của máy, QC hàng ngày bị ngoài khoảng tham chiếu.

– Phân tích QC: ở cả 2 nồng độ. Khi QC đạt mới tiến hành phân tích mẫu.

2.2. Phân tích mẫu

Mẫu bệnh phẩm nên được tiến hành phân tích trong vòng 2 giờ.

Đánh số (hoặc ID của người bệnh); chọn test và vận hành theo protocol máy sẽ tự động phân tích.

2.3. Dải đo được: 0.92 – 29.5g/L. Khi vượt ngưỡng đo trên phải tiến hành pha loãng bệnh phẩm.

VI. NHẬN ĐỊNH KẾT QUẢ

Người bình thường có IgG Kappa trong dải 3,84-12,07 g/L, IgG Lambda trong dải : 1,91-6,74 g/L vả tỷ lệ IgG Kappa/ IgG Lambda từ 1,12-3,12.

VII. NHỮNG SAI SÓT VÀ XỬ TRÍ

– Các yếu tố có thể ảnh hưởng đến kết quả khi:

Mẫu máu bị huyết tán, mỡ máu cao, huyết thanh đục ở mức nhìn thấy được.

– Xử trí:

Khi lấy máu tránh gây vỡ hồng cầu, mẫu bị vỡ hồng cầu nên lấy mẫu máu khác thay thế. Khi huyết thanh đục phải ly tâm trước khi tiến hành xét nghiệm.

ĐỊNH LƯỢNG IgM KAPPA

I. NGUYÊN LÝ

Dựa trên nguyên lý đo độ đục miễn dịch do sự kết hợp giữa kháng nguyên hoà tan (IgM Kappa) và kháng thể đặc hiệu với IgM Kappa. Khi phản ứng kết hợp miễn dịch xảy ra sẽ tạo ra phức hợp miễn dịch có độ đục đo được bằng quang học qua cuvette đo với nguốn sáng của thiết bị.

Với việc đo độ đục các chất chuẩn (Calibrator) biết trước nồng độ, thiết bị đo sẽ thiết lập được đường cong chuẩn để dựa vào đường cong chuẩn này khi đo độ đục của mẫu thử IgM Kappa chưa biết nồng độ trong huyết thanh của người bệnh thì sẽ tính được nồng độ của IgM Kappa trong mẫu huyết thanh của người bệnh.

II. CHỈ ĐỊNH

Theo dõi điều trị bệnh lý đa u tuỷ xương (multiple myeloma)

III. CHỐNG CHỈ ĐỊNH

Không có chống chỉ định.

VI. CHUẨN BỊ

1. Người thực hiện

01 Cán bộ đại học chuyên ngành Hóa sinh và một KTV.

2. Phương tiện, hóa chất

2.1. Phương tiện

Máy xét nghiệm miễn dịch độ đục SPAPLUS hãng Binding Site (Anh)

  • Máy ly tâm;
  • Tủ lạnh để bảo quản hóa chất, chất hiệu chuẩn, QC, mẫu bệnh phẩm;
  • Pipet các loại, ống sample cup, sample tuýp;
  • Ống nghiệm, đầu côn xanh và vàng;
  • Giá đựng ống nghiệm.

2.2. Hoá chất

Kít hoá chất đầy đủ gồm:

+ Antiserum: Human IgM Kappa đủ cho 50 test. Chứa 0.099% sodium azide, 0.1% E-amino-n-caproic acid (EACA), 0.01% benzamidine và 1mM ethylenediaminetetraacetic acid (EDTA) làm chất bảo quản.

+ Dung dịch đệm (Reaction buffer) cho phản ứng đủ cho 50 test. Chứa chất bảo quản có thành phần 0.099% sodium azide.

+ Chất hiệu chuẩn: 6 mức nồng độ từ hấp đến cao ( 6×1,0 mL/lọ). Chứa chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

+ QC: 2 mức nồng độ (thấp & cao), (2×1.0 mL/lọ ). Chứa chất bảo quản: 0.099% sodium azide, 0.1% EACA, 0.01% benzamidine.

– Hóa chất được ổn định đến ngày ghi trên nắp hộp với điều kiện không mở nắp và bảo quản ở nhiệt độ 2-8°C. Không được để hóa chất trong ngăn đá tủ lạnh. Antiserum, đệm, Chất chuẩn và QC có thể để 3 tháng sau khi mở nắp trong tủ lạnh ở nhiệt độ 2-8oC hay 1 tháng trên máy SPAPLUS với điều kiện duy trì chạy máy liên tục.

2.3. Các dụng cụ tiêu hao khác

  • Găng tay, khẩu trang, nước rửa tay, khăn lau tay.
  • Bông, cồn sát trùng, bơm kim tiêm lấy máu.

3. Người bệnh

– Cần giải thích cho người bệnh và người nhà người bệnh về mục đích của xét nghiệm.

– Người bệnh cần phối hợp để lấy máu theo đúng yêu cầu về thời gian và số lượng.

4. Phiếu xét nghiệm

Thực hiện theo y lệnh của bác sỹ lâm sàng trên phiếu xét nghiệm.

V. CÁC BƯỚC TIẾN HÀNH

1. Lấy bệnh phẩm

Thực hiện trên mẫu máu: Dùng huyết thanh (không dùng chất chống đông)

Tính ổn định của mẫu: Mẫu ổn định 16h ở nhiệt độ phòng, 21 ngày ở nhiệt độ 2-8°C. Để bảo quản lâu hơn, mẫu có thể được đông lạnh trong 3 tháng ở nhiệt độ -20°C hoặc thấp hơn nữa. Mẫu huyết thanh chỉ được làm đông một lần.

2. Tiến hành kỹ thuật

2.1. Chuẩn bị máy phân tích

Dựng đường chuẩn: dựa trên chuẩn 6